Incidental Mutation 'R6034:Catsperb'
ID480573
Institutional Source Beutler Lab
Gene Symbol Catsperb
Ensembl Gene ENSMUSG00000047014
Gene Namecation channel sperm associated auxiliary subunit beta
Synonyms4932415G16Rik
MMRRC Submission 044206-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R6034 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location101404653-101626009 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 101575832 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 597 (E597G)
Ref Sequence ENSEMBL: ENSMUSP00000052089 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055156] [ENSMUST00000221241]
Predicted Effect probably benign
Transcript: ENSMUST00000055156
AA Change: E597G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000052089
Gene: ENSMUSG00000047014
AA Change: E597G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
transmembrane domain 73 95 N/A INTRINSIC
Pfam:CATSPERB 569 1088 1.1e-258 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000221241
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221965
Meta Mutation Damage Score 0.0572 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 96.4%
  • 20x: 87.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef4 G T 1: 34,721,903 G80V unknown Het
Ash1l T C 3: 88,985,019 Y1402H probably damaging Het
Atad2 A T 15: 58,108,563 L306Q probably damaging Het
Atp2b4 T A 1: 133,731,907 probably null Het
Atp6v1c2 C A 12: 17,307,500 G95V possibly damaging Het
Birc6 T A 17: 74,615,283 V2192E probably damaging Het
Ccdc129 T A 6: 55,967,681 D462E possibly damaging Het
Ccdc40 A G 11: 119,243,072 M556V possibly damaging Het
Ccin G A 4: 43,985,354 R587K probably benign Het
Cdipt T G 7: 126,978,325 V81G probably damaging Het
Cfh T C 1: 140,163,131 K40E probably damaging Het
Col4a3bp A C 13: 96,609,800 I236L probably benign Het
Cps1 T A 1: 67,157,713 probably null Het
Dnah7c A T 1: 46,457,258 D101V probably benign Het
Fastkd3 T A 13: 68,583,610 W17R probably damaging Het
H2-Ob T C 17: 34,241,218 V30A probably damaging Het
Hist1h1e A G 13: 23,622,313 L62P probably damaging Het
Hmgxb3 T A 18: 61,132,522 H1128L probably damaging Het
Hspbp1 A T 7: 4,677,712 I255N probably damaging Het
Imp4 A G 1: 34,443,456 D91G probably damaging Het
Kcnip4 G T 5: 48,390,941 R241S possibly damaging Het
Lilra5 T C 7: 4,242,134 L259P probably benign Het
Lipf T C 19: 33,964,889 I73T probably benign Het
Lsm7 T C 10: 80,852,908 probably null Het
Luzp2 T A 7: 55,167,224 L141M probably damaging Het
Malrd1 T A 2: 15,845,326 V1252E possibly damaging Het
Map10 T C 8: 125,672,466 L866P probably damaging Het
Mink1 AAGCAGCAGCAGCAGCAGCAGCAG AAGCAGCAGCAGCAGCAGCAG 11: 70,607,040 probably benign Het
Mpp2 T C 11: 102,061,634 I355V possibly damaging Het
Mtrf1l T A 10: 5,823,834 probably benign Het
Myo5c A T 9: 75,255,905 T339S probably benign Het
Naa15 A G 3: 51,442,821 D163G probably damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1303 T A 2: 111,814,357 Y123F probably damaging Het
Oosp2 A G 19: 11,651,515 F74S probably damaging Het
Pard3 C G 8: 127,064,327 probably benign Het
Pcdha1 T A 18: 36,930,598 I105N probably damaging Het
Pcdhgb8 A G 18: 37,762,548 T224A possibly damaging Het
Phf12 A G 11: 78,018,069 N325S probably benign Het
Prom1 T A 5: 44,044,408 probably null Het
Raet1e A G 10: 22,182,091 *252W probably null Het
Sap130 T C 18: 31,689,406 V655A possibly damaging Het
Sec16b A T 1: 157,552,939 K360I probably damaging Het
Sec23ip C T 7: 128,750,203 T101I possibly damaging Het
Selenoo A G 15: 89,099,343 K529R probably benign Het
Slc22a15 A G 3: 101,862,919 F451L possibly damaging Het
St6gal2 T A 17: 55,482,981 S339T probably benign Het
Stard13 A T 5: 151,095,500 probably null Het
Synm A G 7: 67,734,905 V561A probably damaging Het
Tc2n A T 12: 101,651,201 probably null Het
Ugt2b36 T A 5: 87,081,518 D236V probably damaging Het
Vmn1r65 A G 7: 6,008,869 L122P probably damaging Het
Zc3h14 T C 12: 98,771,373 S40P probably benign Het
Zc3hav1l C A 6: 38,295,280 G185C probably damaging Het
Zfp563 G A 17: 33,104,961 A177T probably damaging Het
Other mutations in Catsperb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00532:Catsperb APN 12 101463119 missense probably damaging 1.00
IGL00580:Catsperb APN 12 101591529 missense probably benign 0.01
IGL00661:Catsperb APN 12 101588098 missense probably damaging 1.00
IGL00979:Catsperb APN 12 101415325 missense probably benign 0.34
IGL01154:Catsperb APN 12 101625681 missense possibly damaging 0.79
IGL01360:Catsperb APN 12 101625254 missense probably damaging 1.00
IGL01607:Catsperb APN 12 101480726 splice site probably benign
IGL01679:Catsperb APN 12 101591582 splice site probably null
IGL01827:Catsperb APN 12 101591540 missense probably benign 0.00
IGL01866:Catsperb APN 12 101509311 nonsense probably null
IGL02161:Catsperb APN 12 101409415 splice site probably benign
IGL02177:Catsperb APN 12 101541462 missense probably damaging 1.00
IGL02618:Catsperb APN 12 101480724 splice site probably benign
IGL02721:Catsperb APN 12 101625297 missense probably null 1.00
IGL02828:Catsperb APN 12 101480782 missense probably benign 0.00
R0571:Catsperb UTSW 12 101602774 missense possibly damaging 0.72
R0727:Catsperb UTSW 12 101594355 splice site probably null
R0842:Catsperb UTSW 12 101463048 missense probably damaging 1.00
R1187:Catsperb UTSW 12 101625732 missense probably benign 0.07
R1432:Catsperb UTSW 12 101622217 missense probably damaging 1.00
R1449:Catsperb UTSW 12 101588197 missense probably benign 0.09
R1488:Catsperb UTSW 12 101594267 missense probably damaging 0.97
R1540:Catsperb UTSW 12 101412330 missense probably benign 0.02
R1560:Catsperb UTSW 12 101625726 missense probably benign 0.01
R1563:Catsperb UTSW 12 101588102 missense probably damaging 1.00
R1583:Catsperb UTSW 12 101463114 missense probably damaging 0.96
R1989:Catsperb UTSW 12 101602711 missense probably damaging 1.00
R1993:Catsperb UTSW 12 101602767 missense possibly damaging 0.86
R1995:Catsperb UTSW 12 101602767 missense possibly damaging 0.86
R2037:Catsperb UTSW 12 101507962 missense probably damaging 1.00
R2186:Catsperb UTSW 12 101480782 missense probably benign 0.00
R2217:Catsperb UTSW 12 101594219 missense probably damaging 0.99
R2391:Catsperb UTSW 12 101624706 missense probably damaging 1.00
R2679:Catsperb UTSW 12 101463145 missense probably damaging 1.00
R3848:Catsperb UTSW 12 101509326 missense probably damaging 0.98
R4023:Catsperb UTSW 12 101602683 nonsense probably null
R4507:Catsperb UTSW 12 101480828 critical splice donor site probably null
R4558:Catsperb UTSW 12 101591540 missense possibly damaging 0.94
R4649:Catsperb UTSW 12 101541512 missense probably benign 0.01
R4651:Catsperb UTSW 12 101541512 missense probably benign 0.01
R4866:Catsperb UTSW 12 101507949 missense probably damaging 1.00
R4873:Catsperb UTSW 12 101587985 missense possibly damaging 0.90
R4875:Catsperb UTSW 12 101587985 missense possibly damaging 0.90
R4897:Catsperb UTSW 12 101602766 missense probably damaging 0.98
R5002:Catsperb UTSW 12 101520554 missense probably benign
R5137:Catsperb UTSW 12 101549811 missense probably damaging 0.96
R5396:Catsperb UTSW 12 101594284 missense possibly damaging 0.90
R5450:Catsperb UTSW 12 101446068 missense possibly damaging 0.92
R5484:Catsperb UTSW 12 101575916 missense probably benign 0.38
R5846:Catsperb UTSW 12 101602766 missense probably damaging 0.98
R5905:Catsperb UTSW 12 101602700 missense possibly damaging 0.69
R5906:Catsperb UTSW 12 101510462 missense probably damaging 1.00
R6034:Catsperb UTSW 12 101575832 missense probably benign
R6149:Catsperb UTSW 12 101549839 missense probably damaging 1.00
R6165:Catsperb UTSW 12 101575816 missense possibly damaging 0.90
R6210:Catsperb UTSW 12 101412568 intron probably null
R6297:Catsperb UTSW 12 101591396 unclassified probably null
R6302:Catsperb UTSW 12 101588143 missense possibly damaging 0.95
R6681:Catsperb UTSW 12 101624735 nonsense probably null
R6698:Catsperb UTSW 12 101509207 missense probably damaging 1.00
R6869:Catsperb UTSW 12 101480737 missense probably benign 0.09
R6948:Catsperb UTSW 12 101481068 missense probably benign 0.00
R7035:Catsperb UTSW 12 101415334 missense probably damaging 1.00
R7073:Catsperb UTSW 12 101509238 missense probably benign 0.09
R7100:Catsperb UTSW 12 101446038 missense possibly damaging 0.83
R7338:Catsperb UTSW 12 101480984 missense probably benign 0.08
R7397:Catsperb UTSW 12 101588023 missense possibly damaging 0.84
R7413:Catsperb UTSW 12 101481048 missense probably damaging 1.00
R7422:Catsperb UTSW 12 101588034 missense probably damaging 1.00
R7425:Catsperb UTSW 12 101591498 missense probably damaging 0.96
Predicted Primers
Posted On2017-06-26