Incidental Mutation 'R6034:Hist1h1e'
ID480574
Institutional Source Beutler Lab
Gene Symbol Hist1h1e
Ensembl Gene ENSMUSG00000051627
Gene Namehistone cluster 1, H1e
SynonymsH1-4, H1var2, H1s-4, H1f4, H1e
MMRRC Submission 044206-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6034 (G1)
Quality Score165.009
Status Not validated
Chromosome13
Chromosomal Location23620629-23622558 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 23622313 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 62 (L62P)
Ref Sequence ENSEMBL: ENSMUSP00000057308 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051091] [ENSMUST00000062045] [ENSMUST00000091704]
Predicted Effect probably benign
Transcript: ENSMUST00000051091
SMART Domains Protein: ENSMUSP00000061247
Gene: ENSMUSG00000047246

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
H2B 28 124 1.43e-72 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000062045
AA Change: L62P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000057308
Gene: ENSMUSG00000051627
AA Change: L62P

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
H15 34 99 7.5e-23 SMART
low complexity region 116 219 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000091704
SMART Domains Protein: ENSMUSP00000089296
Gene: ENSMUSG00000047246

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
H2B 28 124 1.43e-72 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120330
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129312
Meta Mutation Damage Score 0.536 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 96.4%
  • 20x: 87.0%
Validation Efficiency
MGI Phenotype FUNCTION: Histones are basic nuclear proteins responsible for nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a replication-dependent histone that is a member of the histone H1 family. Transcripts from this gene lack polyA tails but instead contain a palindromic termination element. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygotes for targeted null mutations are normal, but Hist1h1e/Hist1h1c double knockout males are significantly smaller than normal. The Hist1h1e/Hist1h1d/Hist1h1e triple knockout is lethal by embryonic day 12.5, and heterozygotes are underrepresented. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef4 G T 1: 34,721,903 G80V unknown Het
Ash1l T C 3: 88,985,019 Y1402H probably damaging Het
Atad2 A T 15: 58,108,563 L306Q probably damaging Het
Atp2b4 T A 1: 133,731,907 probably null Het
Atp6v1c2 C A 12: 17,307,500 G95V possibly damaging Het
Birc6 T A 17: 74,615,283 V2192E probably damaging Het
Catsperb A G 12: 101,575,832 E597G probably benign Het
Ccdc129 T A 6: 55,967,681 D462E possibly damaging Het
Ccdc40 A G 11: 119,243,072 M556V possibly damaging Het
Ccin G A 4: 43,985,354 R587K probably benign Het
Cdipt T G 7: 126,978,325 V81G probably damaging Het
Cfh T C 1: 140,163,131 K40E probably damaging Het
Col4a3bp A C 13: 96,609,800 I236L probably benign Het
Cps1 T A 1: 67,157,713 probably null Het
Dnah7c A T 1: 46,457,258 D101V probably benign Het
Fastkd3 T A 13: 68,583,610 W17R probably damaging Het
H2-Ob T C 17: 34,241,218 V30A probably damaging Het
Hmgxb3 T A 18: 61,132,522 H1128L probably damaging Het
Hspbp1 A T 7: 4,677,712 I255N probably damaging Het
Imp4 A G 1: 34,443,456 D91G probably damaging Het
Kcnip4 G T 5: 48,390,941 R241S possibly damaging Het
Lilra5 T C 7: 4,242,134 L259P probably benign Het
Lipf T C 19: 33,964,889 I73T probably benign Het
Lsm7 T C 10: 80,852,908 probably null Het
Luzp2 T A 7: 55,167,224 L141M probably damaging Het
Malrd1 T A 2: 15,845,326 V1252E possibly damaging Het
Map10 T C 8: 125,672,466 L866P probably damaging Het
Mink1 AAGCAGCAGCAGCAGCAGCAGCAG AAGCAGCAGCAGCAGCAGCAG 11: 70,607,040 probably benign Het
Mpp2 T C 11: 102,061,634 I355V possibly damaging Het
Mtrf1l T A 10: 5,823,834 probably benign Het
Myo5c A T 9: 75,255,905 T339S probably benign Het
Naa15 A G 3: 51,442,821 D163G probably damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1303 T A 2: 111,814,357 Y123F probably damaging Het
Oosp2 A G 19: 11,651,515 F74S probably damaging Het
Pard3 C G 8: 127,064,327 probably benign Het
Pcdha1 T A 18: 36,930,598 I105N probably damaging Het
Pcdhgb8 A G 18: 37,762,548 T224A possibly damaging Het
Phf12 A G 11: 78,018,069 N325S probably benign Het
Prom1 T A 5: 44,044,408 probably null Het
Raet1e A G 10: 22,182,091 *252W probably null Het
Sap130 T C 18: 31,689,406 V655A possibly damaging Het
Sec16b A T 1: 157,552,939 K360I probably damaging Het
Sec23ip C T 7: 128,750,203 T101I possibly damaging Het
Selenoo A G 15: 89,099,343 K529R probably benign Het
Slc22a15 A G 3: 101,862,919 F451L possibly damaging Het
St6gal2 T A 17: 55,482,981 S339T probably benign Het
Stard13 A T 5: 151,095,500 probably null Het
Synm A G 7: 67,734,905 V561A probably damaging Het
Tc2n A T 12: 101,651,201 probably null Het
Ugt2b36 T A 5: 87,081,518 D236V probably damaging Het
Vmn1r65 A G 7: 6,008,869 L122P probably damaging Het
Zc3h14 T C 12: 98,771,373 S40P probably benign Het
Zc3hav1l C A 6: 38,295,280 G185C probably damaging Het
Zfp563 G A 17: 33,104,961 A177T probably damaging Het
Other mutations in Hist1h1e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00777:Hist1h1e APN 13 23622022 unclassified probably benign
IGL03354:Hist1h1e APN 13 23622077 unclassified probably benign
PIT4469001:Hist1h1e UTSW 13 23622379 missense probably damaging 1.00
R2339:Hist1h1e UTSW 13 23621960 unclassified probably benign
R3110:Hist1h1e UTSW 13 23621846 unclassified probably benign
R3112:Hist1h1e UTSW 13 23621846 unclassified probably benign
R3757:Hist1h1e UTSW 13 23622257 nonsense probably null
R3758:Hist1h1e UTSW 13 23622257 nonsense probably null
R5116:Hist1h1e UTSW 13 23622287 missense probably damaging 1.00
R6034:Hist1h1e UTSW 13 23622313 missense probably damaging 1.00
R7008:Hist1h1e UTSW 13 23622209 missense probably damaging 1.00
R7051:Hist1h1e UTSW 13 23622439 missense probably benign 0.00
R7317:Hist1h1e UTSW 13 23622367 missense probably damaging 1.00
Predicted Primers
Posted On2017-06-26