Incidental Mutation 'R6034:Col4a3bp'
ID480576
Institutional Source Beutler Lab
Gene Symbol Col4a3bp
Ensembl Gene ENSMUSG00000021669
Gene Namecollagen, type IV, alpha 3 (Goodpasture antigen) binding protein
SynonymsGPBP, 2810404O15Rik, Cert, ceramide transport protein, 9230101K08Rik
MMRRC Submission 044206-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6034 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location96542618-96640167 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 96609800 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 236 (I236L)
Ref Sequence ENSEMBL: ENSMUSP00000136766 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077672] [ENSMUST00000109444] [ENSMUST00000179226]
Predicted Effect probably benign
Transcript: ENSMUST00000077672
AA Change: I236L

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000076856
Gene: ENSMUSG00000021669
AA Change: I236L

DomainStartEndE-ValueType
PH 24 119 4.52e-21 SMART
low complexity region 138 150 N/A INTRINSIC
coiled coil region 273 301 N/A INTRINSIC
START 398 619 1.15e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109444
AA Change: I236L

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000105070
Gene: ENSMUSG00000021669
AA Change: I236L

DomainStartEndE-ValueType
PH 24 119 4.52e-21 SMART
low complexity region 138 150 N/A INTRINSIC
coiled coil region 273 301 N/A INTRINSIC
START 372 593 1.15e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179226
AA Change: I236L

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000136766
Gene: ENSMUSG00000021669
AA Change: I236L

DomainStartEndE-ValueType
PH 24 119 4.52e-21 SMART
low complexity region 138 150 N/A INTRINSIC
coiled coil region 273 301 N/A INTRINSIC
START 372 593 1.15e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220464
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222434
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223019
Meta Mutation Damage Score 0.094 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 96.4%
  • 20x: 87.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a kinase that specifically phosphorylates the N-terminal region of the non-collagenous domain of the alpha 3 chain of type IV collagen, known as the Goodpasture antigen. Goodpasture disease is the result of an autoimmune response directed at this antigen. One isoform of this protein is also involved in ceramide intracellular transport. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mice display embryonic lethality during organogenesis with reduced embryo size, impaired heart function, abnormal heart morphology, abnormal mitochondrial morphology and physiology, abnormal endoplasmic reticulum morphology, and decreased cell proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef4 G T 1: 34,721,903 G80V unknown Het
Ash1l T C 3: 88,985,019 Y1402H probably damaging Het
Atad2 A T 15: 58,108,563 L306Q probably damaging Het
Atp2b4 T A 1: 133,731,907 probably null Het
Atp6v1c2 C A 12: 17,307,500 G95V possibly damaging Het
Birc6 T A 17: 74,615,283 V2192E probably damaging Het
Catsperb A G 12: 101,575,832 E597G probably benign Het
Ccdc129 T A 6: 55,967,681 D462E possibly damaging Het
Ccdc40 A G 11: 119,243,072 M556V possibly damaging Het
Ccin G A 4: 43,985,354 R587K probably benign Het
Cdipt T G 7: 126,978,325 V81G probably damaging Het
Cfh T C 1: 140,163,131 K40E probably damaging Het
Cps1 T A 1: 67,157,713 probably null Het
Dnah7c A T 1: 46,457,258 D101V probably benign Het
Fastkd3 T A 13: 68,583,610 W17R probably damaging Het
H2-Ob T C 17: 34,241,218 V30A probably damaging Het
Hist1h1e A G 13: 23,622,313 L62P probably damaging Het
Hmgxb3 T A 18: 61,132,522 H1128L probably damaging Het
Hspbp1 A T 7: 4,677,712 I255N probably damaging Het
Imp4 A G 1: 34,443,456 D91G probably damaging Het
Kcnip4 G T 5: 48,390,941 R241S possibly damaging Het
Lilra5 T C 7: 4,242,134 L259P probably benign Het
Lipf T C 19: 33,964,889 I73T probably benign Het
Lsm7 T C 10: 80,852,908 probably null Het
Luzp2 T A 7: 55,167,224 L141M probably damaging Het
Malrd1 T A 2: 15,845,326 V1252E possibly damaging Het
Map10 T C 8: 125,672,466 L866P probably damaging Het
Mink1 AAGCAGCAGCAGCAGCAGCAGCAG AAGCAGCAGCAGCAGCAGCAG 11: 70,607,040 probably benign Het
Mpp2 T C 11: 102,061,634 I355V possibly damaging Het
Mtrf1l T A 10: 5,823,834 probably benign Het
Myo5c A T 9: 75,255,905 T339S probably benign Het
Naa15 A G 3: 51,442,821 D163G probably damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1303 T A 2: 111,814,357 Y123F probably damaging Het
Oosp2 A G 19: 11,651,515 F74S probably damaging Het
Pard3 C G 8: 127,064,327 probably benign Het
Pcdha1 T A 18: 36,930,598 I105N probably damaging Het
Pcdhgb8 A G 18: 37,762,548 T224A possibly damaging Het
Phf12 A G 11: 78,018,069 N325S probably benign Het
Prom1 T A 5: 44,044,408 probably null Het
Raet1e A G 10: 22,182,091 *252W probably null Het
Sap130 T C 18: 31,689,406 V655A possibly damaging Het
Sec16b A T 1: 157,552,939 K360I probably damaging Het
Sec23ip C T 7: 128,750,203 T101I possibly damaging Het
Selenoo A G 15: 89,099,343 K529R probably benign Het
Slc22a15 A G 3: 101,862,919 F451L possibly damaging Het
St6gal2 T A 17: 55,482,981 S339T probably benign Het
Stard13 A T 5: 151,095,500 probably null Het
Synm A G 7: 67,734,905 V561A probably damaging Het
Tc2n A T 12: 101,651,201 probably null Het
Ugt2b36 T A 5: 87,081,518 D236V probably damaging Het
Vmn1r65 A G 7: 6,008,869 L122P probably damaging Het
Zc3h14 T C 12: 98,771,373 S40P probably benign Het
Zc3hav1l C A 6: 38,295,280 G185C probably damaging Het
Zfp563 G A 17: 33,104,961 A177T probably damaging Het
Other mutations in Col4a3bp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01133:Col4a3bp APN 13 96614802 missense probably damaging 0.99
IGL02121:Col4a3bp APN 13 96599474 missense probably benign 0.45
IGL02207:Col4a3bp APN 13 96624792 critical splice donor site probably null
IGL02285:Col4a3bp APN 13 96616482 missense probably benign 0.10
IGL02425:Col4a3bp APN 13 96609882 missense probably damaging 1.00
IGL02749:Col4a3bp APN 13 96629135 missense possibly damaging 0.60
IGL03288:Col4a3bp APN 13 96634192 missense probably benign 0.00
PIT4508001:Col4a3bp UTSW 13 96630776 missense probably damaging 1.00
R0197:Col4a3bp UTSW 13 96549287 missense probably benign 0.05
R0317:Col4a3bp UTSW 13 96634121 nonsense probably null
R2103:Col4a3bp UTSW 13 96634886 missense probably damaging 1.00
R2104:Col4a3bp UTSW 13 96634886 missense probably damaging 1.00
R4664:Col4a3bp UTSW 13 96599457 missense probably benign 0.01
R4782:Col4a3bp UTSW 13 96612265 missense probably benign
R4824:Col4a3bp UTSW 13 96616487 missense probably benign
R5060:Col4a3bp UTSW 13 96603155 missense probably benign 0.37
R5131:Col4a3bp UTSW 13 96614835 missense probably damaging 1.00
R5385:Col4a3bp UTSW 13 96629067 missense possibly damaging 0.94
R5503:Col4a3bp UTSW 13 96543239 missense possibly damaging 0.61
R6034:Col4a3bp UTSW 13 96609800 missense probably benign 0.06
R7193:Col4a3bp UTSW 13 96630833 critical splice donor site probably null
Predicted Primers
Posted On2017-06-26