Incidental Mutation 'R6034:St6gal2'
ID480581
Institutional Source Beutler Lab
Gene Symbol St6gal2
Ensembl Gene ENSMUSG00000024172
Gene Namebeta galactoside alpha 2,6 sialyltransferase 2
SynonymsST6Gal II, C230064G14Rik
MMRRC Submission 044206-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6034 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location55445382-55514581 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 55482981 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 339 (S339T)
Ref Sequence ENSEMBL: ENSMUSP00000120762 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025000] [ENSMUST00000086878] [ENSMUST00000133899]
Predicted Effect probably benign
Transcript: ENSMUST00000025000
SMART Domains Protein: ENSMUSP00000025000
Gene: ENSMUSG00000024172

DomainStartEndE-ValueType
transmembrane domain 13 30 N/A INTRINSIC
low complexity region 230 241 N/A INTRINSIC
low complexity region 251 257 N/A INTRINSIC
Pfam:Glyco_transf_29 272 501 3.7e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000086878
SMART Domains Protein: ENSMUSP00000084091
Gene: ENSMUSG00000024172

DomainStartEndE-ValueType
transmembrane domain 13 30 N/A INTRINSIC
Pfam:Glyco_transf_29 234 438 9.1e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133899
AA Change: S339T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000120762
Gene: ENSMUSG00000024172
AA Change: S339T

DomainStartEndE-ValueType
transmembrane domain 13 30 N/A INTRINSIC
Pfam:Glyco_transf_29 207 316 5.1e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153220
Meta Mutation Damage Score 0.1292 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 96.4%
  • 20x: 87.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a sialyltransferase. The encoded type II transmembrane protein catalyzes the transfer of sialic acid from CMP to an oligosaccharide substrate. Polymorphisms at this locus may be associated with variations in risperidone response in schizophrenic patients. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jan 2012]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef4 G T 1: 34,721,903 G80V unknown Het
Ash1l T C 3: 88,985,019 Y1402H probably damaging Het
Atad2 A T 15: 58,108,563 L306Q probably damaging Het
Atp2b4 T A 1: 133,731,907 probably null Het
Atp6v1c2 C A 12: 17,307,500 G95V possibly damaging Het
Birc6 T A 17: 74,615,283 V2192E probably damaging Het
Catsperb A G 12: 101,575,832 E597G probably benign Het
Ccdc129 T A 6: 55,967,681 D462E possibly damaging Het
Ccdc40 A G 11: 119,243,072 M556V possibly damaging Het
Ccin G A 4: 43,985,354 R587K probably benign Het
Cdipt T G 7: 126,978,325 V81G probably damaging Het
Cfh T C 1: 140,163,131 K40E probably damaging Het
Col4a3bp A C 13: 96,609,800 I236L probably benign Het
Cps1 T A 1: 67,157,713 probably null Het
Dnah7c A T 1: 46,457,258 D101V probably benign Het
Fastkd3 T A 13: 68,583,610 W17R probably damaging Het
H2-Ob T C 17: 34,241,218 V30A probably damaging Het
Hist1h1e A G 13: 23,622,313 L62P probably damaging Het
Hmgxb3 T A 18: 61,132,522 H1128L probably damaging Het
Hspbp1 A T 7: 4,677,712 I255N probably damaging Het
Imp4 A G 1: 34,443,456 D91G probably damaging Het
Kcnip4 G T 5: 48,390,941 R241S possibly damaging Het
Lilra5 T C 7: 4,242,134 L259P probably benign Het
Lipf T C 19: 33,964,889 I73T probably benign Het
Lsm7 T C 10: 80,852,908 probably null Het
Luzp2 T A 7: 55,167,224 L141M probably damaging Het
Malrd1 T A 2: 15,845,326 V1252E possibly damaging Het
Map10 T C 8: 125,672,466 L866P probably damaging Het
Mink1 AAGCAGCAGCAGCAGCAGCAGCAG AAGCAGCAGCAGCAGCAGCAG 11: 70,607,040 probably benign Het
Mpp2 T C 11: 102,061,634 I355V possibly damaging Het
Mtrf1l T A 10: 5,823,834 probably benign Het
Myo5c A T 9: 75,255,905 T339S probably benign Het
Naa15 A G 3: 51,442,821 D163G probably damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1303 T A 2: 111,814,357 Y123F probably damaging Het
Oosp2 A G 19: 11,651,515 F74S probably damaging Het
Pard3 C G 8: 127,064,327 probably benign Het
Pcdha1 T A 18: 36,930,598 I105N probably damaging Het
Pcdhgb8 A G 18: 37,762,548 T224A possibly damaging Het
Phf12 A G 11: 78,018,069 N325S probably benign Het
Prom1 T A 5: 44,044,408 probably null Het
Raet1e A G 10: 22,182,091 *252W probably null Het
Sap130 T C 18: 31,689,406 V655A possibly damaging Het
Sec16b A T 1: 157,552,939 K360I probably damaging Het
Sec23ip C T 7: 128,750,203 T101I possibly damaging Het
Selenoo A G 15: 89,099,343 K529R probably benign Het
Slc22a15 A G 3: 101,862,919 F451L possibly damaging Het
Stard13 A T 5: 151,095,500 probably null Het
Synm A G 7: 67,734,905 V561A probably damaging Het
Tc2n A T 12: 101,651,201 probably null Het
Ugt2b36 T A 5: 87,081,518 D236V probably damaging Het
Vmn1r65 A G 7: 6,008,869 L122P probably damaging Het
Zc3h14 T C 12: 98,771,373 S40P probably benign Het
Zc3hav1l C A 6: 38,295,280 G185C probably damaging Het
Zfp563 G A 17: 33,104,961 A177T probably damaging Het
Other mutations in St6gal2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02689:St6gal2 APN 17 55482595 missense probably damaging 1.00
R0496:St6gal2 UTSW 17 55482014 missense probably damaging 0.96
R0652:St6gal2 UTSW 17 55498289 missense probably benign
R1456:St6gal2 UTSW 17 55490931 splice site probably benign
R1470:St6gal2 UTSW 17 55490943 missense probably damaging 1.00
R1470:St6gal2 UTSW 17 55490943 missense probably damaging 1.00
R1676:St6gal2 UTSW 17 55496395 critical splice donor site probably null
R2092:St6gal2 UTSW 17 55510266 missense probably damaging 1.00
R3120:St6gal2 UTSW 17 55482110 missense probably benign 0.00
R3875:St6gal2 UTSW 17 55482697 missense probably benign 0.02
R3928:St6gal2 UTSW 17 55496323 missense possibly damaging 0.92
R3929:St6gal2 UTSW 17 55496323 missense possibly damaging 0.92
R4512:St6gal2 UTSW 17 55483017 missense probably benign 0.09
R4513:St6gal2 UTSW 17 55483017 missense probably benign 0.09
R4514:St6gal2 UTSW 17 55483017 missense probably benign 0.09
R4564:St6gal2 UTSW 17 55482647 missense probably damaging 1.00
R4701:St6gal2 UTSW 17 55496344 missense probably damaging 1.00
R4716:St6gal2 UTSW 17 55510366 missense probably benign 0.01
R6034:St6gal2 UTSW 17 55482981 missense probably benign
R6356:St6gal2 UTSW 17 55482013 missense probably damaging 1.00
R6455:St6gal2 UTSW 17 55482513 missense probably benign 0.01
Predicted Primers
Posted On2017-06-26