Incidental Mutation 'R6034:Lipf'
ID480588
Institutional Source Beutler Lab
Gene Symbol Lipf
Ensembl Gene ENSMUSG00000024768
Gene Namelipase, gastric
Synonyms
MMRRC Submission 044206-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R6034 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location33961187-33976810 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 33964889 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 73 (I73T)
Ref Sequence ENSEMBL: ENSMUSP00000025680 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025680]
Predicted Effect probably benign
Transcript: ENSMUST00000025680
AA Change: I73T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000025680
Gene: ENSMUSG00000024768
AA Change: I73T

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Abhydro_lipase 34 96 2.9e-27 PFAM
Pfam:Abhydrolase_1 77 377 2.3e-26 PFAM
Pfam:Abhydrolase_5 78 372 1.5e-9 PFAM
Meta Mutation Damage Score 0.1208 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 96.4%
  • 20x: 87.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes gastric lipase, an enzyme involved in the digestion of dietary triglycerides in the gastrointestinal tract, and responsible for 30% of fat digestion processes occurring in human. It is secreted by gastric chief cells in the fundic mucosa of the stomach, and it hydrolyzes the ester bonds of triglycerides under acidic pH conditions. The gene is a member of a conserved gene family of lipases that play distinct roles in neutral lipid metabolism. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef4 G T 1: 34,721,903 G80V unknown Het
Ash1l T C 3: 88,985,019 Y1402H probably damaging Het
Atad2 A T 15: 58,108,563 L306Q probably damaging Het
Atp2b4 T A 1: 133,731,907 probably null Het
Atp6v1c2 C A 12: 17,307,500 G95V possibly damaging Het
Birc6 T A 17: 74,615,283 V2192E probably damaging Het
Catsperb A G 12: 101,575,832 E597G probably benign Het
Ccdc129 T A 6: 55,967,681 D462E possibly damaging Het
Ccdc40 A G 11: 119,243,072 M556V possibly damaging Het
Ccin G A 4: 43,985,354 R587K probably benign Het
Cdipt T G 7: 126,978,325 V81G probably damaging Het
Cfh T C 1: 140,163,131 K40E probably damaging Het
Col4a3bp A C 13: 96,609,800 I236L probably benign Het
Cps1 T A 1: 67,157,713 probably null Het
Dnah7c A T 1: 46,457,258 D101V probably benign Het
Fastkd3 T A 13: 68,583,610 W17R probably damaging Het
H2-Ob T C 17: 34,241,218 V30A probably damaging Het
Hist1h1e A G 13: 23,622,313 L62P probably damaging Het
Hmgxb3 T A 18: 61,132,522 H1128L probably damaging Het
Hspbp1 A T 7: 4,677,712 I255N probably damaging Het
Imp4 A G 1: 34,443,456 D91G probably damaging Het
Kcnip4 G T 5: 48,390,941 R241S possibly damaging Het
Lilra5 T C 7: 4,242,134 L259P probably benign Het
Lsm7 T C 10: 80,852,908 probably null Het
Luzp2 T A 7: 55,167,224 L141M probably damaging Het
Malrd1 T A 2: 15,845,326 V1252E possibly damaging Het
Map10 T C 8: 125,672,466 L866P probably damaging Het
Mink1 AAGCAGCAGCAGCAGCAGCAGCAG AAGCAGCAGCAGCAGCAGCAG 11: 70,607,040 probably benign Het
Mpp2 T C 11: 102,061,634 I355V possibly damaging Het
Mtrf1l T A 10: 5,823,834 probably benign Het
Myo5c A T 9: 75,255,905 T339S probably benign Het
Naa15 A G 3: 51,442,821 D163G probably damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1303 T A 2: 111,814,357 Y123F probably damaging Het
Oosp2 A G 19: 11,651,515 F74S probably damaging Het
Pard3 C G 8: 127,064,327 probably benign Het
Pcdha1 T A 18: 36,930,598 I105N probably damaging Het
Pcdhgb8 A G 18: 37,762,548 T224A possibly damaging Het
Phf12 A G 11: 78,018,069 N325S probably benign Het
Prom1 T A 5: 44,044,408 probably null Het
Raet1e A G 10: 22,182,091 *252W probably null Het
Sap130 T C 18: 31,689,406 V655A possibly damaging Het
Sec16b A T 1: 157,552,939 K360I probably damaging Het
Sec23ip C T 7: 128,750,203 T101I possibly damaging Het
Selenoo A G 15: 89,099,343 K529R probably benign Het
Slc22a15 A G 3: 101,862,919 F451L possibly damaging Het
St6gal2 T A 17: 55,482,981 S339T probably benign Het
Stard13 A T 5: 151,095,500 probably null Het
Synm A G 7: 67,734,905 V561A probably damaging Het
Tc2n A T 12: 101,651,201 probably null Het
Ugt2b36 T A 5: 87,081,518 D236V probably damaging Het
Vmn1r65 A G 7: 6,008,869 L122P probably damaging Het
Zc3h14 T C 12: 98,771,373 S40P probably benign Het
Zc3hav1l C A 6: 38,295,280 G185C probably damaging Het
Zfp563 G A 17: 33,104,961 A177T probably damaging Het
Other mutations in Lipf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01902:Lipf APN 19 33970779 missense probably benign 0.33
IGL02024:Lipf APN 19 33976595 missense probably damaging 1.00
R1427:Lipf UTSW 19 33965600 missense probably damaging 1.00
R1454:Lipf UTSW 19 33970732 splice site probably benign
R1484:Lipf UTSW 19 33964780 missense probably benign 0.00
R1636:Lipf UTSW 19 33976535 missense probably damaging 1.00
R1720:Lipf UTSW 19 33965666 nonsense probably null
R1916:Lipf UTSW 19 33965675 missense probably benign 0.07
R2010:Lipf UTSW 19 33973546 missense probably benign
R2519:Lipf UTSW 19 33965525 missense probably damaging 0.99
R2937:Lipf UTSW 19 33973038 missense probably damaging 1.00
R4063:Lipf UTSW 19 33965565 missense probably benign 0.43
R4640:Lipf UTSW 19 33968797 missense probably damaging 0.98
R4671:Lipf UTSW 19 33976676 missense possibly damaging 0.94
R4818:Lipf UTSW 19 33965688 missense probably benign 0.04
R5619:Lipf UTSW 19 33966892 missense possibly damaging 0.95
R6034:Lipf UTSW 19 33964889 missense probably benign
R6045:Lipf UTSW 19 33966844 missense probably damaging 1.00
R6464:Lipf UTSW 19 33973544 missense probably benign 0.00
Predicted Primers
Posted On2017-06-26