Incidental Mutation 'R5999:Zer1'
ID480703
Institutional Source Beutler Lab
Gene Symbol Zer1
Ensembl Gene ENSMUSG00000039686
Gene Namezyg-11 related, cell cycle regulator
SynonymsC230075L19Rik, Zyg11bl
MMRRC Submission 044178-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.274) question?
Stock #R5999 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location30097283-30124585 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30104997 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 462 (L462P)
Ref Sequence ENSEMBL: ENSMUSP00000109307 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044751] [ENSMUST00000113677]
Predicted Effect probably damaging
Transcript: ENSMUST00000044751
AA Change: L475P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046441
Gene: ENSMUSG00000039686
AA Change: L475P

DomainStartEndE-ValueType
SCOP:d1jdha_ 405 774 3e-15 SMART
Blast:ARM 440 480 2e-18 BLAST
Blast:ARM 524 569 4e-24 BLAST
Blast:ARM 571 613 6e-22 BLAST
Blast:ARM 617 656 7e-8 BLAST
Blast:ARM 686 724 6e-18 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000113677
AA Change: L462P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109307
Gene: ENSMUSG00000039686
AA Change: L462P

DomainStartEndE-ValueType
SCOP:d1jdha_ 392 761 3e-15 SMART
Blast:ARM 427 467 2e-18 BLAST
Blast:ARM 511 556 4e-24 BLAST
Blast:ARM 558 600 2e-21 BLAST
Blast:ARM 604 643 7e-8 BLAST
Blast:ARM 673 711 6e-18 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131858
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133354
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139128
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149818
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152068
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152285
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154231
Meta Mutation Damage Score 0.18 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.2%
  • 20x: 90.9%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of an E3 ubiquitin ligase complex that may be involved in meiosis. The encoded protein contains three leucine-rich repeat motifs. [provided by RefSeq, Nov 2012]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T C 11: 78,285,468 F1799L probably damaging Het
Acot5 A G 12: 84,075,554 D304G probably benign Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Aes T C 10: 81,561,264 S25P probably damaging Het
Akap9 A G 5: 4,043,925 N2149S probably damaging Het
Akp3 T A 1: 87,127,541 Y437N probably damaging Het
Anks1b C T 10: 90,359,048 T530I probably damaging Het
Bnc2 C T 4: 84,555,900 R3H probably benign Het
Cald1 A T 6: 34,746,338 probably benign Het
Capn9 A G 8: 124,589,078 T87A probably damaging Het
Ccdc88c A G 12: 100,968,354 L175P probably damaging Het
Cd226 T C 18: 89,207,219 V80A probably damaging Het
Cd44 A T 2: 102,845,397 N310K probably benign Het
Cenpc1 T A 5: 86,012,263 K905N probably damaging Het
Cept1 A T 3: 106,533,443 D133E probably damaging Het
Cltc T C 11: 86,704,129 H1381R possibly damaging Het
Col4a4 T A 1: 82,492,619 T730S unknown Het
Col6a4 A T 9: 106,067,921 M998K probably benign Het
Cpne6 T C 14: 55,513,059 V119A probably benign Het
Ddx54 G T 5: 120,623,580 A474S probably benign Het
Dmbx1 G T 4: 115,918,176 N302K probably damaging Het
Dnah8 A G 17: 30,663,305 E617G probably benign Het
Ei24 A G 9: 36,793,307 V10A probably benign Het
Elp3 A G 14: 65,531,540 V543A probably benign Het
Frmd3 T C 4: 74,170,691 I375T possibly damaging Het
Gm6408 A G 5: 146,484,257 D232G possibly damaging Het
Inmt A T 6: 55,174,948 Y12* probably null Het
Inpp5k G T 11: 75,633,100 A44S probably damaging Het
Kalrn T A 16: 34,357,343 T169S probably damaging Het
Kif28 A T 1: 179,695,790 F992I probably damaging Het
Kmt2c A T 5: 25,284,205 Y1199N probably damaging Het
Large2 C T 2: 92,366,058 E475K probably benign Het
Mroh2b T A 15: 4,912,884 probably null Het
Mrpl42 T C 10: 95,500,479 probably benign Het
Muc5b A T 7: 141,857,379 H1354L unknown Het
Myof C A 19: 37,939,856 E1095* probably null Het
Ncor2 A G 5: 125,033,441 V1385A probably damaging Het
Nr5a2 T C 1: 136,845,542 Y474C probably damaging Het
Olfr1156 A T 2: 87,949,801 probably null Het
Olfr1438-ps1 C T 19: 12,333,644 D71N probably damaging Het
Olfr338 A G 2: 36,377,310 D178G probably damaging Het
Pogz A G 3: 94,856,117 T67A possibly damaging Het
Prep T A 10: 45,072,129 probably null Het
Prf1 A G 10: 61,303,028 D255G probably damaging Het
Psme2 A G 14: 55,590,082 L24P probably damaging Het
Scmh1 T A 4: 120,505,515 probably null Het
Scpep1 A G 11: 88,929,313 V383A possibly damaging Het
Slc4a10 A T 2: 62,243,431 N279I probably benign Het
Sphkap T C 1: 83,267,405 S1498G probably benign Het
Spinkl C A 18: 44,168,139 S44I probably damaging Het
Tanc2 G A 11: 105,867,717 R768Q probably damaging Het
Tmem213 A G 6: 38,109,451 Q14R probably benign Het
Tns1 A T 1: 73,928,097 Y1172* probably null Het
Ugt2b37 A C 5: 87,254,177 I198M probably benign Het
Usp17lb A C 7: 104,840,345 I457M probably damaging Het
Usp6nl G T 2: 6,441,339 R709L probably damaging Het
Zfhx2 A G 14: 55,074,005 S411P probably benign Het
Other mutations in Zer1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01098:Zer1 APN 2 30108220 critical splice donor site probably null
IGL01630:Zer1 APN 2 30101831 missense probably damaging 1.00
IGL02126:Zer1 APN 2 30104916 missense probably benign 0.10
IGL02338:Zer1 APN 2 30113393 missense probably damaging 1.00
IGL02817:Zer1 APN 2 30103394 missense probably damaging 0.99
PIT4402001:Zer1 UTSW 2 30101120 missense probably damaging 0.96
PIT4495001:Zer1 UTSW 2 30103543 missense probably benign 0.01
R0390:Zer1 UTSW 2 30108213 splice site probably benign
R0506:Zer1 UTSW 2 30101807 missense probably damaging 1.00
R0606:Zer1 UTSW 2 30104797 splice site probably benign
R0928:Zer1 UTSW 2 30101763 critical splice donor site probably null
R1167:Zer1 UTSW 2 30108246 missense probably benign 0.00
R1819:Zer1 UTSW 2 30110218 missense probably benign 0.18
R2040:Zer1 UTSW 2 30108274 missense probably damaging 1.00
R2041:Zer1 UTSW 2 30108274 missense probably damaging 1.00
R2042:Zer1 UTSW 2 30108274 missense probably damaging 1.00
R2092:Zer1 UTSW 2 30108274 missense probably damaging 1.00
R2168:Zer1 UTSW 2 30104875 missense probably damaging 1.00
R2243:Zer1 UTSW 2 30101127 missense probably damaging 0.99
R2254:Zer1 UTSW 2 30108274 missense probably damaging 1.00
R2255:Zer1 UTSW 2 30108274 missense probably damaging 1.00
R2311:Zer1 UTSW 2 30101822 missense probably damaging 0.99
R2993:Zer1 UTSW 2 30101897 missense probably damaging 1.00
R3010:Zer1 UTSW 2 30113285 missense probably benign 0.13
R3731:Zer1 UTSW 2 30110911 missense probably benign 0.44
R4038:Zer1 UTSW 2 30107523 missense probably damaging 1.00
R5241:Zer1 UTSW 2 30104970 missense probably damaging 1.00
R5433:Zer1 UTSW 2 30100986 intron probably benign
R5443:Zer1 UTSW 2 30110996 missense probably damaging 1.00
R5524:Zer1 UTSW 2 30104854 missense probably damaging 1.00
R5936:Zer1 UTSW 2 30107667 missense probably damaging 0.97
R6598:Zer1 UTSW 2 30113274 missense probably damaging 1.00
R6965:Zer1 UTSW 2 30101047 missense possibly damaging 0.87
R7030:Zer1 UTSW 2 30111021 missense probably benign 0.00
R7190:Zer1 UTSW 2 30103432 missense probably damaging 1.00
R7218:Zer1 UTSW 2 30105012 missense probably damaging 1.00
R7252:Zer1 UTSW 2 30101892 missense probably damaging 0.99
R7383:Zer1 UTSW 2 30111241 missense probably damaging 1.00
R7417:Zer1 UTSW 2 30102822 missense probably damaging 1.00
R7459:Zer1 UTSW 2 30113325 missense probably damaging 1.00
R7463:Zer1 UTSW 2 30113437 start gained probably benign
R7477:Zer1 UTSW 2 30107976 missense probably null 0.34
X0026:Zer1 UTSW 2 30104895 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACAGCCTCCTTATGGTCATTG -3'
(R):5'- CAGCAAGTATTAGTTGAGCCTGG -3'

Sequencing Primer
(F):5'- ATGGTCATTGTCCACCTGGCAG -3'
(R):5'- AGTTAAAAGCTAGCCCTGGC -3'
Posted On2017-06-26