Incidental Mutation 'R5999:Anks1b'
ID480731
Institutional Source Beutler Lab
Gene Symbol Anks1b
Ensembl Gene ENSMUSG00000058589
Gene Nameankyrin repeat and sterile alpha motif domain containing 1B
SynonymsC030032C09Rik, AIDA-1b, LOC380650, Gm10937, E530015N03Rik
MMRRC Submission 044178-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.242) question?
Stock #R5999 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location89873509-90973300 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 90359048 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 530 (T530I)
Ref Sequence ENSEMBL: ENSMUSP00000138539 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099368] [ENSMUST00000182907] [ENSMUST00000182936] [ENSMUST00000183156]
Predicted Effect probably damaging
Transcript: ENSMUST00000099368
AA Change: T530I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000096968
Gene: ENSMUSG00000058589
AA Change: T530I

DomainStartEndE-ValueType
low complexity region 21 46 N/A INTRINSIC
ANK 58 87 1.88e-5 SMART
ANK 91 123 3.13e-2 SMART
ANK 127 156 6.92e-4 SMART
ANK 160 189 3.08e-1 SMART
ANK 193 222 1.43e-5 SMART
ANK 225 254 4.75e-2 SMART
low complexity region 498 513 N/A INTRINSIC
low complexity region 551 577 N/A INTRINSIC
low complexity region 659 670 N/A INTRINSIC
SAM 806 875 2.06e-19 SMART
SAM 880 931 4.44e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182907
SMART Domains Protein: ENSMUSP00000138614
Gene: ENSMUSG00000058589

DomainStartEndE-ValueType
low complexity region 21 45 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000182936
AA Change: T496I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000138209
Gene: ENSMUSG00000058589
AA Change: T496I

DomainStartEndE-ValueType
low complexity region 21 46 N/A INTRINSIC
ANK 58 87 1.88e-5 SMART
ANK 91 123 3.13e-2 SMART
ANK 127 156 6.92e-4 SMART
ANK 160 189 3.08e-1 SMART
ANK 193 222 1.43e-5 SMART
ANK 225 254 5.03e2 SMART
low complexity region 464 479 N/A INTRINSIC
low complexity region 517 543 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000183156
AA Change: T530I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138539
Gene: ENSMUSG00000058589
AA Change: T530I

DomainStartEndE-ValueType
low complexity region 21 46 N/A INTRINSIC
ANK 58 87 1.88e-5 SMART
ANK 91 123 3.13e-2 SMART
ANK 127 156 6.92e-4 SMART
ANK 160 189 3.08e-1 SMART
ANK 193 222 1.43e-5 SMART
ANK 225 254 4.75e-2 SMART
low complexity region 498 513 N/A INTRINSIC
low complexity region 551 577 N/A INTRINSIC
low complexity region 659 670 N/A INTRINSIC
SAM 806 875 2.06e-19 SMART
SAM 880 948 5.66e-17 SMART
low complexity region 968 983 N/A INTRINSIC
PTB 1056 1194 2.94e-38 SMART
Meta Mutation Damage Score 0.148 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.2%
  • 20x: 90.9%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-domain protein that is predominantly expressed in brain and testis. This protein interacts with amyloid beta protein precursor (AbetaPP) and may have a role in normal brain development, and in the pathogenesis of Alzheimer's disease. Expression of this gene has been shown to be elevated in patients with pre-B cell acute lymphocytic leukemia associated with t(1;19) translocation. Alternatively spliced transcript variants encoding different isoforms (some with different subcellular localization, PMID:15004329) have been described for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a conditional allele activated in neurons alters hippocampal synaptic transmission. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T C 11: 78,285,468 F1799L probably damaging Het
Acot5 A G 12: 84,075,554 D304G probably benign Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Aes T C 10: 81,561,264 S25P probably damaging Het
Akap9 A G 5: 4,043,925 N2149S probably damaging Het
Akp3 T A 1: 87,127,541 Y437N probably damaging Het
Bnc2 C T 4: 84,555,900 R3H probably benign Het
Cald1 A T 6: 34,746,338 probably benign Het
Capn9 A G 8: 124,589,078 T87A probably damaging Het
Ccdc88c A G 12: 100,968,354 L175P probably damaging Het
Cd226 T C 18: 89,207,219 V80A probably damaging Het
Cd44 A T 2: 102,845,397 N310K probably benign Het
Cenpc1 T A 5: 86,012,263 K905N probably damaging Het
Cept1 A T 3: 106,533,443 D133E probably damaging Het
Cltc T C 11: 86,704,129 H1381R possibly damaging Het
Col4a4 T A 1: 82,492,619 T730S unknown Het
Col6a4 A T 9: 106,067,921 M998K probably benign Het
Cpne6 T C 14: 55,513,059 V119A probably benign Het
Ddx54 G T 5: 120,623,580 A474S probably benign Het
Dmbx1 G T 4: 115,918,176 N302K probably damaging Het
Dnah8 A G 17: 30,663,305 E617G probably benign Het
Ei24 A G 9: 36,793,307 V10A probably benign Het
Elp3 A G 14: 65,531,540 V543A probably benign Het
Frmd3 T C 4: 74,170,691 I375T possibly damaging Het
Gm6408 A G 5: 146,484,257 D232G possibly damaging Het
Inmt A T 6: 55,174,948 Y12* probably null Het
Inpp5k G T 11: 75,633,100 A44S probably damaging Het
Kalrn T A 16: 34,357,343 T169S probably damaging Het
Kif28 A T 1: 179,695,790 F992I probably damaging Het
Kmt2c A T 5: 25,284,205 Y1199N probably damaging Het
Large2 C T 2: 92,366,058 E475K probably benign Het
Mroh2b T A 15: 4,912,884 probably null Het
Mrpl42 T C 10: 95,500,479 probably benign Het
Muc5b A T 7: 141,857,379 H1354L unknown Het
Myof C A 19: 37,939,856 E1095* probably null Het
Ncor2 A G 5: 125,033,441 V1385A probably damaging Het
Nr5a2 T C 1: 136,845,542 Y474C probably damaging Het
Olfr1156 A T 2: 87,949,801 probably null Het
Olfr1438-ps1 C T 19: 12,333,644 D71N probably damaging Het
Olfr338 A G 2: 36,377,310 D178G probably damaging Het
Pogz A G 3: 94,856,117 T67A possibly damaging Het
Prep T A 10: 45,072,129 probably null Het
Prf1 A G 10: 61,303,028 D255G probably damaging Het
Psme2 A G 14: 55,590,082 L24P probably damaging Het
Scmh1 T A 4: 120,505,515 probably null Het
Scpep1 A G 11: 88,929,313 V383A possibly damaging Het
Slc4a10 A T 2: 62,243,431 N279I probably benign Het
Sphkap T C 1: 83,267,405 S1498G probably benign Het
Spinkl C A 18: 44,168,139 S44I probably damaging Het
Tanc2 G A 11: 105,867,717 R768Q probably damaging Het
Tmem213 A G 6: 38,109,451 Q14R probably benign Het
Tns1 A T 1: 73,928,097 Y1172* probably null Het
Ugt2b37 A C 5: 87,254,177 I198M probably benign Het
Usp17lb A C 7: 104,840,345 I457M probably damaging Het
Usp6nl G T 2: 6,441,339 R709L probably damaging Het
Zer1 A G 2: 30,104,997 L462P probably damaging Het
Zfhx2 A G 14: 55,074,005 S411P probably benign Het
Other mutations in Anks1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01669:Anks1b APN 10 90897238 splice site probably benign
IGL01890:Anks1b APN 10 90644527 missense probably benign 0.15
IGL01966:Anks1b APN 10 90895132 missense probably damaging 1.00
IGL02176:Anks1b APN 10 90042668 missense probably damaging 0.99
IGL02205:Anks1b APN 10 90071094 missense probably benign 0.00
IGL02465:Anks1b APN 10 90163265 nonsense probably null
IGL02534:Anks1b APN 10 90895117 missense probably benign 0.45
IGL02554:Anks1b APN 10 90921378 missense probably damaging 1.00
IGL02820:Anks1b APN 10 90077059 missense possibly damaging 0.93
IGL03164:Anks1b APN 10 90042692 missense probably damaging 1.00
R0096:Anks1b UTSW 10 90074062 missense possibly damaging 0.90
R0482:Anks1b UTSW 10 90359195 missense probably benign 0.00
R0542:Anks1b UTSW 10 90073967 splice site probably benign
R0848:Anks1b UTSW 10 90071125 missense probably damaging 0.99
R1056:Anks1b UTSW 10 90921429 splice site probably null
R1398:Anks1b UTSW 10 90050029 missense probably damaging 1.00
R1446:Anks1b UTSW 10 90511073 missense probably benign 0.00
R1548:Anks1b UTSW 10 90049985 missense possibly damaging 0.79
R1551:Anks1b UTSW 10 90076981 missense probably benign 0.00
R1607:Anks1b UTSW 10 90042548 missense probably damaging 1.00
R1667:Anks1b UTSW 10 90511184 critical splice donor site probably null
R1701:Anks1b UTSW 10 90049954 missense probably damaging 1.00
R1843:Anks1b UTSW 10 90512889 critical splice donor site probably null
R1899:Anks1b UTSW 10 90260756 missense probably damaging 1.00
R1957:Anks1b UTSW 10 90049930 missense probably damaging 1.00
R2036:Anks1b UTSW 10 90969853 missense probably damaging 0.99
R2279:Anks1b UTSW 10 90050096 missense probably damaging 1.00
R2280:Anks1b UTSW 10 90966302 missense probably damaging 1.00
R2937:Anks1b UTSW 10 90077066 missense probably damaging 1.00
R3739:Anks1b UTSW 10 90033216 missense probably damaging 1.00
R4061:Anks1b UTSW 10 90307622 missense probably damaging 0.98
R4459:Anks1b UTSW 10 90510844 missense probably damaging 1.00
R4479:Anks1b UTSW 10 90049892 missense probably damaging 1.00
R4510:Anks1b UTSW 10 90510790 missense probably benign 0.01
R4511:Anks1b UTSW 10 90510790 missense probably benign 0.01
R4780:Anks1b UTSW 10 89873732 missense probably damaging 1.00
R4785:Anks1b UTSW 10 90914750 missense probably null 0.88
R4790:Anks1b UTSW 10 90163275 missense probably damaging 0.99
R5012:Anks1b UTSW 10 90359137 missense probably benign 0.06
R5400:Anks1b UTSW 10 90512824 missense probably damaging 1.00
R5586:Anks1b UTSW 10 90077064 missense probably damaging 0.98
R5687:Anks1b UTSW 10 90914711 missense probably benign 0.03
R5899:Anks1b UTSW 10 90923517 splice site probably null
R5917:Anks1b UTSW 10 90576941 intron probably benign
R6080:Anks1b UTSW 10 90966349 nonsense probably null
R6216:Anks1b UTSW 10 90260756 missense probably damaging 1.00
R6265:Anks1b UTSW 10 90941500 missense probably damaging 1.00
R6298:Anks1b UTSW 10 90680837 missense probably damaging 1.00
R6337:Anks1b UTSW 10 90921296 missense probably benign 0.27
R6522:Anks1b UTSW 10 90897327 intron probably benign
R6843:Anks1b UTSW 10 90948598 missense probably damaging 1.00
R6852:Anks1b UTSW 10 90260654 missense probably damaging 1.00
R6933:Anks1b UTSW 10 90069490 missense probably damaging 1.00
R7114:Anks1b UTSW 10 90307698 missense probably damaging 1.00
X0064:Anks1b UTSW 10 90512845 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCATCAACTGATTGGTTAGTGTCTC -3'
(R):5'- GTTTTACCTGCGTGTTCAGC -3'

Sequencing Primer
(F):5'- AATCACGCCCATTGTAGGTG -3'
(R):5'- GCGTGTTCAGCTCCCTCG -3'
Posted On2017-06-26