Incidental Mutation 'R6000:Dner'
ID480755
Institutional Source Beutler Lab
Gene Symbol Dner
Ensembl Gene ENSMUSG00000036766
Gene Namedelta/notch-like EGF repeat containing
SynonymsA930026D19Rik, BET
MMRRC Submission 044179-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6000 (G1)
Quality Score135.008
Status Validated
Chromosome1
Chromosomal Location84369839-84696221 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 84383929 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 653 (M653K)
Ref Sequence ENSEMBL: ENSMUSP00000042927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049126]
Predicted Effect possibly damaging
Transcript: ENSMUST00000049126
AA Change: M653K

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000042927
Gene: ENSMUSG00000036766
AA Change: M653K

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
EGF 47 92 9.85e-5 SMART
EGF 97 133 2.33e-6 SMART
EGF 306 348 1.8e1 SMART
EGF 352 390 5e-6 SMART
EGF_CA 392 428 8.97e-8 SMART
EGF 433 466 3.54e-6 SMART
EGF 471 503 4.66e-6 SMART
EGF_CA 505 541 1.61e-9 SMART
EGF 546 579 9.7e-4 SMART
EGF_CA 581 617 4.52e-13 SMART
transmembrane domain 639 661 N/A INTRINSIC
Meta Mutation Damage Score 0.204 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.7%
Validation Efficiency 100% (64/64)
MGI Phenotype PHENOTYPE: Homozygous null mice display delayed cerebellar development, abnormal Bergmann glial cells, abnormal Purkinje cell innervation, and impaired coordination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310034C09Rik T C 16: 88,759,539 C214R possibly damaging Het
5430403G16Rik A G 5: 109,676,864 V240A probably benign Het
Ahnak A T 19: 9,013,111 K3920* probably null Het
Alox12b A G 11: 69,169,568 D650G probably damaging Het
Amt A T 9: 108,301,485 Y400F probably benign Het
Ankrd11 A G 8: 122,891,195 S1973P possibly damaging Het
Aoc1 A T 6: 48,907,639 T539S probably benign Het
Arhgap44 CTGCT CTGCTTGCT 11: 65,032,084 probably null Het
Ccdc15 C T 9: 37,315,764 G292S probably benign Het
Ccdc162 C T 10: 41,561,163 C287Y possibly damaging Het
Cdk15 G A 1: 59,289,659 G244D probably damaging Het
Cep290 T A 10: 100,541,787 Y1560N probably damaging Het
Cic A C 7: 25,271,998 I385L probably benign Het
Cobl A T 11: 12,369,684 F231L probably benign Het
Cpeb1 T C 7: 81,361,680 D171G possibly damaging Het
Csnk1g2 T A 10: 80,638,944 V305E probably damaging Het
Cyp2c29 A G 19: 39,307,606 probably null Het
Dst T A 1: 34,212,223 M4311K possibly damaging Het
Ep400 A G 5: 110,683,201 S2200P unknown Het
Ephb2 A T 4: 136,684,030 S440T possibly damaging Het
Ercc1 A T 7: 19,347,161 probably benign Het
Folh1 T A 7: 86,725,934 N615Y probably benign Het
Gm35911 G T 5: 99,941,367 A164S probably benign Het
Gm7298 T C 6: 121,765,079 Y487H possibly damaging Het
Gucy1b2 A T 14: 62,419,050 I286N probably benign Het
Hr A G 14: 70,567,833 D1005G probably damaging Het
Ifrd1 C A 12: 40,216,244 V117F possibly damaging Het
Ift140 A T 17: 25,036,960 T210S probably benign Het
Igll1 C A 16: 16,863,941 probably benign Het
Ino80 G T 2: 119,374,508 S1512R probably benign Het
Intu A T 3: 40,654,148 K197* probably null Het
Kdm6b A G 11: 69,403,598 L1216P unknown Het
Klrb1c T G 6: 128,784,157 D169A probably damaging Het
Lamp3 T A 16: 19,700,948 T162S possibly damaging Het
Mapk10 G A 5: 102,966,475 P319L probably damaging Het
Mapk10 G A 5: 102,966,476 P319S probably damaging Het
Mical3 T C 6: 121,021,320 T702A probably benign Het
Mstn C T 1: 53,061,669 probably benign Het
Nckap1l T C 15: 103,478,815 S706P probably benign Het
Nckap5l G A 15: 99,426,885 T579I probably damaging Het
Olfr1197 C A 2: 88,729,231 A123S probably damaging Het
Olfr1341 A T 4: 118,710,244 N279I probably damaging Het
Olfr285 G A 15: 98,313,436 T38I probably benign Het
Pcdh18 A C 3: 49,754,464 S801A probably damaging Het
Pde11a A T 2: 76,017,860 D874E probably damaging Het
Pfdn6 G T 17: 33,939,615 P62T probably damaging Het
Pkd1l1 A G 11: 8,950,427 I38T probably benign Het
Prkdc A T 16: 15,829,697 I3662F possibly damaging Het
Psg26 A T 7: 18,482,692 L74* probably null Het
Rassf6 A G 5: 90,603,877 V341A probably damaging Het
Rsad2 C A 12: 26,447,151 probably null Het
Rwdd3 A G 3: 121,156,513 Y95H probably damaging Het
Scfd1 A G 12: 51,445,674 I589V possibly damaging Het
Sgsm1 A T 5: 113,286,838 I131N probably damaging Het
Tecpr1 A G 5: 144,211,421 S389P probably benign Het
Tle3 T A 9: 61,374,014 I29N probably damaging Het
Tmem63c C A 12: 87,057,197 N73K probably damaging Het
Tpm2 T A 4: 43,518,301 probably null Het
Trak2 A T 1: 58,911,812 D405E possibly damaging Het
Ttn C A 2: 76,745,172 A23380S probably damaging Het
Ttn A T 2: 76,885,151 probably benign Het
Tub T C 7: 109,029,650 S391P probably damaging Het
Ush2a G T 1: 188,267,026 E178* probably null Het
Wdr66 A G 5: 123,254,372 probably benign Het
Wisp3 T C 10: 39,158,300 Y102C probably damaging Het
Ylpm1 C A 12: 84,997,256 T256K unknown Het
Other mutations in Dner
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01434:Dner APN 1 84384010 missense probably benign 0.13
IGL02251:Dner APN 1 84384026 missense probably damaging 1.00
IGL02904:Dner APN 1 84534944 missense probably damaging 0.96
IGL03063:Dner APN 1 84585338 missense possibly damaging 0.90
R0013:Dner UTSW 1 84494893 splice site probably benign
R0112:Dner UTSW 1 84583053 missense probably benign 0.06
R0196:Dner UTSW 1 84370832 missense probably damaging 1.00
R0282:Dner UTSW 1 84405965 missense probably damaging 1.00
R0282:Dner UTSW 1 84445380 splice site probably benign
R0942:Dner UTSW 1 84585309 splice site probably benign
R1143:Dner UTSW 1 84445464 missense probably damaging 1.00
R1483:Dner UTSW 1 84585549 utr 5 prime probably benign
R1585:Dner UTSW 1 84585456 missense probably benign 0.05
R1636:Dner UTSW 1 84585330 missense possibly damaging 0.89
R1739:Dner UTSW 1 84370784 missense probably damaging 0.99
R1756:Dner UTSW 1 84445590 missense probably damaging 0.98
R1960:Dner UTSW 1 84445456 missense probably damaging 0.98
R2061:Dner UTSW 1 84405989 missense probably damaging 1.00
R2157:Dner UTSW 1 84383938 missense possibly damaging 0.88
R2265:Dner UTSW 1 84585549 utr 5 prime probably benign
R2382:Dner UTSW 1 84370823 missense probably damaging 1.00
R2507:Dner UTSW 1 84583080 missense probably damaging 1.00
R3053:Dner UTSW 1 84384026 missense probably damaging 1.00
R3917:Dner UTSW 1 84585549 utr 5 prime probably benign
R4530:Dner UTSW 1 84583015 missense probably damaging 1.00
R4552:Dner UTSW 1 84383857 missense probably damaging 1.00
R4579:Dner UTSW 1 84383816 missense probably damaging 0.97
R4593:Dner UTSW 1 84695728 start codon destroyed probably null
R4711:Dner UTSW 1 84383897 missense possibly damaging 0.75
R5102:Dner UTSW 1 84405970 missense probably damaging 1.00
R5314:Dner UTSW 1 84580739 missense probably damaging 1.00
R5370:Dner UTSW 1 84585549 utr 5 prime probably benign
R6644:Dner UTSW 1 84395707 missense probably damaging 1.00
R6764:Dner UTSW 1 84494781 missense probably damaging 1.00
R6948:Dner UTSW 1 84406017 missense probably damaging 1.00
R6991:Dner UTSW 1 84476402 nonsense probably null
R7056:Dner UTSW 1 84580736 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- TAGTGATAGCATCGCCCTGG -3'
(R):5'- CCTTCCCAGTTTAGATGACCCTTAG -3'

Sequencing Primer
(F):5'- AGGTGTGACGTCTCCCTCAC -3'
(R):5'- CCCTTAGGTGAAGTTAGCGAC -3'
Posted On2017-06-26