Incidental Mutation 'R6000:Olfr1341'
ID480766
Institutional Source Beutler Lab
Gene Symbol Olfr1341
Ensembl Gene ENSMUSG00000046790
Gene Nameolfactory receptor 1341
SynonymsMOR258-1, GA_x6K02T2QD9B-18838170-18837232
MMRRC Submission 044179-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R6000 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location118703523-118713438 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 118710244 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 279 (N279I)
Ref Sequence ENSEMBL: ENSMUSP00000149466 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061215] [ENSMUST00000214131] [ENSMUST00000215117]
Predicted Effect probably damaging
Transcript: ENSMUST00000061215
AA Change: N279I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000095523
Gene: ENSMUSG00000046790
AA Change: N279I

DomainStartEndE-ValueType
Pfam:7tm_4 31 306 8.4e-54 PFAM
Pfam:7TM_GPCR_Srsx 35 304 1.5e-7 PFAM
Pfam:7tm_1 41 290 1.7e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214131
AA Change: N279I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000215117
AA Change: N279I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.7%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310034C09Rik T C 16: 88,759,539 C214R possibly damaging Het
5430403G16Rik A G 5: 109,676,864 V240A probably benign Het
Ahnak A T 19: 9,013,111 K3920* probably null Het
Alox12b A G 11: 69,169,568 D650G probably damaging Het
Amt A T 9: 108,301,485 Y400F probably benign Het
Ankrd11 A G 8: 122,891,195 S1973P possibly damaging Het
Aoc1 A T 6: 48,907,639 T539S probably benign Het
Arhgap44 CTGCT CTGCTTGCT 11: 65,032,084 probably null Het
Ccdc15 C T 9: 37,315,764 G292S probably benign Het
Ccdc162 C T 10: 41,561,163 C287Y possibly damaging Het
Cdk15 G A 1: 59,289,659 G244D probably damaging Het
Cep290 T A 10: 100,541,787 Y1560N probably damaging Het
Cic A C 7: 25,271,998 I385L probably benign Het
Cobl A T 11: 12,369,684 F231L probably benign Het
Cpeb1 T C 7: 81,361,680 D171G possibly damaging Het
Csnk1g2 T A 10: 80,638,944 V305E probably damaging Het
Cyp2c29 A G 19: 39,307,606 probably null Het
Dner A T 1: 84,383,929 M653K possibly damaging Het
Dst T A 1: 34,212,223 M4311K possibly damaging Het
Ep400 A G 5: 110,683,201 S2200P unknown Het
Ephb2 A T 4: 136,684,030 S440T possibly damaging Het
Ercc1 A T 7: 19,347,161 probably benign Het
Folh1 T A 7: 86,725,934 N615Y probably benign Het
Gm35911 G T 5: 99,941,367 A164S probably benign Het
Gm7298 T C 6: 121,765,079 Y487H possibly damaging Het
Gucy1b2 A T 14: 62,419,050 I286N probably benign Het
Hr A G 14: 70,567,833 D1005G probably damaging Het
Ifrd1 C A 12: 40,216,244 V117F possibly damaging Het
Ift140 A T 17: 25,036,960 T210S probably benign Het
Igll1 C A 16: 16,863,941 probably benign Het
Ino80 G T 2: 119,374,508 S1512R probably benign Het
Intu A T 3: 40,654,148 K197* probably null Het
Kdm6b A G 11: 69,403,598 L1216P unknown Het
Klrb1c T G 6: 128,784,157 D169A probably damaging Het
Lamp3 T A 16: 19,700,948 T162S possibly damaging Het
Mapk10 G A 5: 102,966,475 P319L probably damaging Het
Mapk10 G A 5: 102,966,476 P319S probably damaging Het
Mical3 T C 6: 121,021,320 T702A probably benign Het
Mstn C T 1: 53,061,669 probably benign Het
Nckap1l T C 15: 103,478,815 S706P probably benign Het
Nckap5l G A 15: 99,426,885 T579I probably damaging Het
Olfr1197 C A 2: 88,729,231 A123S probably damaging Het
Olfr285 G A 15: 98,313,436 T38I probably benign Het
Pcdh18 A C 3: 49,754,464 S801A probably damaging Het
Pde11a A T 2: 76,017,860 D874E probably damaging Het
Pfdn6 G T 17: 33,939,615 P62T probably damaging Het
Pkd1l1 A G 11: 8,950,427 I38T probably benign Het
Prkdc A T 16: 15,829,697 I3662F possibly damaging Het
Psg26 A T 7: 18,482,692 L74* probably null Het
Rassf6 A G 5: 90,603,877 V341A probably damaging Het
Rsad2 C A 12: 26,447,151 probably null Het
Rwdd3 A G 3: 121,156,513 Y95H probably damaging Het
Scfd1 A G 12: 51,445,674 I589V possibly damaging Het
Sgsm1 A T 5: 113,286,838 I131N probably damaging Het
Tecpr1 A G 5: 144,211,421 S389P probably benign Het
Tle3 T A 9: 61,374,014 I29N probably damaging Het
Tmem63c C A 12: 87,057,197 N73K probably damaging Het
Tpm2 T A 4: 43,518,301 probably null Het
Trak2 A T 1: 58,911,812 D405E possibly damaging Het
Ttn C A 2: 76,745,172 A23380S probably damaging Het
Ttn A T 2: 76,885,151 probably benign Het
Tub T C 7: 109,029,650 S391P probably damaging Het
Ush2a G T 1: 188,267,026 E178* probably null Het
Wdr66 A G 5: 123,254,372 probably benign Het
Wisp3 T C 10: 39,158,300 Y102C probably damaging Het
Ylpm1 C A 12: 84,997,256 T256K unknown Het
Other mutations in Olfr1341
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00983:Olfr1341 APN 4 118709922 missense probably damaging 1.00
IGL02699:Olfr1341 APN 4 118710198 missense probably benign 0.36
IGL02798:Olfr1341 APN 4 118709499 missense probably damaging 0.97
IGL03271:Olfr1341 APN 4 118709785 missense probably damaging 0.99
R0085:Olfr1341 UTSW 4 118709881 missense probably benign 0.18
R0355:Olfr1341 UTSW 4 118709611 missense probably benign 0.06
R1134:Olfr1341 UTSW 4 118710279 missense probably damaging 0.97
R1561:Olfr1341 UTSW 4 118709554 missense probably damaging 0.99
R1574:Olfr1341 UTSW 4 118709554 missense probably damaging 0.99
R2167:Olfr1341 UTSW 4 118710055 missense probably benign 0.18
R2182:Olfr1341 UTSW 4 118710345 makesense probably null
R2237:Olfr1341 UTSW 4 118709995 missense probably damaging 1.00
R3775:Olfr1341 UTSW 4 118710154 missense probably damaging 1.00
R6249:Olfr1341 UTSW 4 118709713 missense probably damaging 1.00
R6331:Olfr1341 UTSW 4 118709947 missense probably benign 0.34
R6527:Olfr1341 UTSW 4 118709848 missense possibly damaging 0.56
X0063:Olfr1341 UTSW 4 118709755 missense probably damaging 1.00
Z1088:Olfr1341 UTSW 4 118710226 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGGTTTAGTGTCATACTGATCCCC -3'
(R):5'- GCATGGCTGCTGCTATTATG -3'

Sequencing Primer
(F):5'- AGTGTCATACTGATCCCCCTGTC -3'
(R):5'- CATGGCTGCTGCTATTATGTGAATC -3'
Posted On2017-06-26