Incidental Mutation 'R6000:Gm7298'
ID480778
Institutional Source Beutler Lab
Gene Symbol Gm7298
Ensembl Gene ENSMUSG00000108022
Gene Namepredicted gene 7298
Synonyms
MMRRC Submission 044179-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.214) question?
Stock #R6000 (G1)
Quality Score196.009
Status Validated
Chromosome6
Chromosomal Location121732932-121789084 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 121765079 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 487 (Y487H)
Ref Sequence ENSEMBL: ENSMUSP00000145242 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000204124]
Predicted Effect possibly damaging
Transcript: ENSMUST00000204124
AA Change: Y487H

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000145242
Gene: ENSMUSG00000108022
AA Change: Y487H

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:A2M_N 128 221 4e-18 PFAM
A2M_N_2 449 599 1e-45 SMART
A2M 740 830 2.1e-39 SMART
Pfam:Thiol-ester_cl 963 992 1.9e-15 PFAM
Pfam:A2M_comp 1012 1268 1.6e-90 PFAM
A2M_recep 1378 1465 4.3e-42 SMART
Meta Mutation Damage Score 0.222 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.7%
Validation Efficiency 100% (64/64)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310034C09Rik T C 16: 88,759,539 C214R possibly damaging Het
5430403G16Rik A G 5: 109,676,864 V240A probably benign Het
Ahnak A T 19: 9,013,111 K3920* probably null Het
Alox12b A G 11: 69,169,568 D650G probably damaging Het
Amt A T 9: 108,301,485 Y400F probably benign Het
Ankrd11 A G 8: 122,891,195 S1973P possibly damaging Het
Aoc1 A T 6: 48,907,639 T539S probably benign Het
Arhgap44 CTGCT CTGCTTGCT 11: 65,032,084 probably null Het
Ccdc15 C T 9: 37,315,764 G292S probably benign Het
Ccdc162 C T 10: 41,561,163 C287Y possibly damaging Het
Cdk15 G A 1: 59,289,659 G244D probably damaging Het
Cep290 T A 10: 100,541,787 Y1560N probably damaging Het
Cic A C 7: 25,271,998 I385L probably benign Het
Cobl A T 11: 12,369,684 F231L probably benign Het
Cpeb1 T C 7: 81,361,680 D171G possibly damaging Het
Csnk1g2 T A 10: 80,638,944 V305E probably damaging Het
Cyp2c29 A G 19: 39,307,606 probably null Het
Dner A T 1: 84,383,929 M653K possibly damaging Het
Dst T A 1: 34,212,223 M4311K possibly damaging Het
Ep400 A G 5: 110,683,201 S2200P unknown Het
Ephb2 A T 4: 136,684,030 S440T possibly damaging Het
Ercc1 A T 7: 19,347,161 probably benign Het
Folh1 T A 7: 86,725,934 N615Y probably benign Het
Gm35911 G T 5: 99,941,367 A164S probably benign Het
Gucy1b2 A T 14: 62,419,050 I286N probably benign Het
Hr A G 14: 70,567,833 D1005G probably damaging Het
Ifrd1 C A 12: 40,216,244 V117F possibly damaging Het
Ift140 A T 17: 25,036,960 T210S probably benign Het
Igll1 C A 16: 16,863,941 probably benign Het
Ino80 G T 2: 119,374,508 S1512R probably benign Het
Intu A T 3: 40,654,148 K197* probably null Het
Kdm6b A G 11: 69,403,598 L1216P unknown Het
Klrb1c T G 6: 128,784,157 D169A probably damaging Het
Lamp3 T A 16: 19,700,948 T162S possibly damaging Het
Mapk10 G A 5: 102,966,475 P319L probably damaging Het
Mapk10 G A 5: 102,966,476 P319S probably damaging Het
Mical3 T C 6: 121,021,320 T702A probably benign Het
Mstn C T 1: 53,061,669 probably benign Het
Nckap1l T C 15: 103,478,815 S706P probably benign Het
Nckap5l G A 15: 99,426,885 T579I probably damaging Het
Olfr1197 C A 2: 88,729,231 A123S probably damaging Het
Olfr1341 A T 4: 118,710,244 N279I probably damaging Het
Olfr285 G A 15: 98,313,436 T38I probably benign Het
Pcdh18 A C 3: 49,754,464 S801A probably damaging Het
Pde11a A T 2: 76,017,860 D874E probably damaging Het
Pfdn6 G T 17: 33,939,615 P62T probably damaging Het
Pkd1l1 A G 11: 8,950,427 I38T probably benign Het
Prkdc A T 16: 15,829,697 I3662F possibly damaging Het
Psg26 A T 7: 18,482,692 L74* probably null Het
Rassf6 A G 5: 90,603,877 V341A probably damaging Het
Rsad2 C A 12: 26,447,151 probably null Het
Rwdd3 A G 3: 121,156,513 Y95H probably damaging Het
Scfd1 A G 12: 51,445,674 I589V possibly damaging Het
Sgsm1 A T 5: 113,286,838 I131N probably damaging Het
Tecpr1 A G 5: 144,211,421 S389P probably benign Het
Tle3 T A 9: 61,374,014 I29N probably damaging Het
Tmem63c C A 12: 87,057,197 N73K probably damaging Het
Tpm2 T A 4: 43,518,301 probably null Het
Trak2 A T 1: 58,911,812 D405E possibly damaging Het
Ttn C A 2: 76,745,172 A23380S probably damaging Het
Ttn A T 2: 76,885,151 probably benign Het
Tub T C 7: 109,029,650 S391P probably damaging Het
Ush2a G T 1: 188,267,026 E178* probably null Het
Wdr66 A G 5: 123,254,372 probably benign Het
Wisp3 T C 10: 39,158,300 Y102C probably damaging Het
Ylpm1 C A 12: 84,997,256 T256K unknown Het
Other mutations in Gm7298
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0030:Gm7298 UTSW 6 121774050 missense probably benign
R4978:Gm7298 UTSW 6 121733117 critical splice donor site probably null
R4980:Gm7298 UTSW 6 121759239 intron probably null
R6160:Gm7298 UTSW 6 121764927 missense probably benign 0.28
R6180:Gm7298 UTSW 6 121760823 missense probably benign 0.01
R6243:Gm7298 UTSW 6 121779137 missense possibly damaging 0.88
R6266:Gm7298 UTSW 6 121782704 missense probably damaging 1.00
R6268:Gm7298 UTSW 6 121779073 missense possibly damaging 0.83
R6363:Gm7298 UTSW 6 121788606 missense probably damaging 1.00
R6364:Gm7298 UTSW 6 121779443 missense possibly damaging 0.90
R6527:Gm7298 UTSW 6 121769710 missense probably benign 0.01
R6538:Gm7298 UTSW 6 121776173 missense probably damaging 0.98
R6801:Gm7298 UTSW 6 121775809 missense probably benign 0.03
R6884:Gm7298 UTSW 6 121760521 missense possibly damaging 0.74
R6935:Gm7298 UTSW 6 121767694 missense probably benign 0.02
R7051:Gm7298 UTSW 6 121775034 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TTCCAGGTCAAACACAAAGAGG -3'
(R):5'- CAAGACTTTGTTCTAACTGTGCTAG -3'

Sequencing Primer
(F):5'- CCCATTTCTATTGCATGGAGGAAAG -3'
(R):5'- ACTGTGCTAGAAGAAATAGATGAATC -3'
Posted On2017-06-26