Incidental Mutation 'R6000:Ccdc162'
ID480790
Institutional Source Beutler Lab
Gene Symbol Ccdc162
Ensembl Gene ENSMUSG00000075225
Gene Namecoiled-coil domain containing 162
Synonyms5033413D22Rik
MMRRC Submission 044179-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R6000 (G1)
Quality Score160.009
Status Validated
Chromosome10
Chromosomal Location41538846-41716634 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 41561163 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 287 (C287Y)
Ref Sequence ENSEMBL: ENSMUSP00000097516 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019955] [ENSMUST00000099932] [ENSMUST00000179614] [ENSMUST00000189488] [ENSMUST00000219054]
Predicted Effect probably benign
Transcript: ENSMUST00000019955
SMART Domains Protein: ENSMUSP00000019955
Gene: ENSMUSG00000075225

DomainStartEndE-ValueType
coiled coil region 1 37 N/A INTRINSIC
low complexity region 116 138 N/A INTRINSIC
coiled coil region 177 217 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000095227
AA Change: C100Y
SMART Domains Protein: ENSMUSP00000092852
Gene: ENSMUSG00000075225
AA Change: C100Y

DomainStartEndE-ValueType
coiled coil region 140 179 N/A INTRINSIC
low complexity region 304 326 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000099932
AA Change: C287Y

PolyPhen 2 Score 0.745 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000097516
Gene: ENSMUSG00000075225
AA Change: C287Y

DomainStartEndE-ValueType
coiled coil region 327 366 N/A INTRINSIC
low complexity region 490 512 N/A INTRINSIC
coiled coil region 551 607 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160002
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164074
Predicted Effect probably benign
Transcript: ENSMUST00000179614
AA Change: C477Y

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000135966
Gene: ENSMUSG00000075225
AA Change: C477Y

DomainStartEndE-ValueType
coiled coil region 517 556 N/A INTRINSIC
low complexity region 680 702 N/A INTRINSIC
coiled coil region 741 797 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189488
AA Change: C1750Y

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000140774
Gene: ENSMUSG00000075225
AA Change: C1750Y

DomainStartEndE-ValueType
low complexity region 328 347 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000219054
AA Change: C477Y

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
Meta Mutation Damage Score 0.0732 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.7%
Validation Efficiency 100% (64/64)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310034C09Rik T C 16: 88,759,539 C214R possibly damaging Het
5430403G16Rik A G 5: 109,676,864 V240A probably benign Het
Ahnak A T 19: 9,013,111 K3920* probably null Het
Alox12b A G 11: 69,169,568 D650G probably damaging Het
Amt A T 9: 108,301,485 Y400F probably benign Het
Ankrd11 A G 8: 122,891,195 S1973P possibly damaging Het
Aoc1 A T 6: 48,907,639 T539S probably benign Het
Arhgap44 CTGCT CTGCTTGCT 11: 65,032,084 probably null Het
Ccdc15 C T 9: 37,315,764 G292S probably benign Het
Cdk15 G A 1: 59,289,659 G244D probably damaging Het
Cep290 T A 10: 100,541,787 Y1560N probably damaging Het
Cic A C 7: 25,271,998 I385L probably benign Het
Cobl A T 11: 12,369,684 F231L probably benign Het
Cpeb1 T C 7: 81,361,680 D171G possibly damaging Het
Csnk1g2 T A 10: 80,638,944 V305E probably damaging Het
Cyp2c29 A G 19: 39,307,606 probably null Het
Dner A T 1: 84,383,929 M653K possibly damaging Het
Dst T A 1: 34,212,223 M4311K possibly damaging Het
Ep400 A G 5: 110,683,201 S2200P unknown Het
Ephb2 A T 4: 136,684,030 S440T possibly damaging Het
Ercc1 A T 7: 19,347,161 probably benign Het
Folh1 T A 7: 86,725,934 N615Y probably benign Het
Gm35911 G T 5: 99,941,367 A164S probably benign Het
Gm7298 T C 6: 121,765,079 Y487H possibly damaging Het
Gucy1b2 A T 14: 62,419,050 I286N probably benign Het
Hr A G 14: 70,567,833 D1005G probably damaging Het
Ifrd1 C A 12: 40,216,244 V117F possibly damaging Het
Ift140 A T 17: 25,036,960 T210S probably benign Het
Igll1 C A 16: 16,863,941 probably benign Het
Ino80 G T 2: 119,374,508 S1512R probably benign Het
Intu A T 3: 40,654,148 K197* probably null Het
Kdm6b A G 11: 69,403,598 L1216P unknown Het
Klrb1c T G 6: 128,784,157 D169A probably damaging Het
Lamp3 T A 16: 19,700,948 T162S possibly damaging Het
Mapk10 G A 5: 102,966,475 P319L probably damaging Het
Mapk10 G A 5: 102,966,476 P319S probably damaging Het
Mical3 T C 6: 121,021,320 T702A probably benign Het
Mstn C T 1: 53,061,669 probably benign Het
Nckap1l T C 15: 103,478,815 S706P probably benign Het
Nckap5l G A 15: 99,426,885 T579I probably damaging Het
Olfr1197 C A 2: 88,729,231 A123S probably damaging Het
Olfr1341 A T 4: 118,710,244 N279I probably damaging Het
Olfr285 G A 15: 98,313,436 T38I probably benign Het
Pcdh18 A C 3: 49,754,464 S801A probably damaging Het
Pde11a A T 2: 76,017,860 D874E probably damaging Het
Pfdn6 G T 17: 33,939,615 P62T probably damaging Het
Pkd1l1 A G 11: 8,950,427 I38T probably benign Het
Prkdc A T 16: 15,829,697 I3662F possibly damaging Het
Psg26 A T 7: 18,482,692 L74* probably null Het
Rassf6 A G 5: 90,603,877 V341A probably damaging Het
Rsad2 C A 12: 26,447,151 probably null Het
Rwdd3 A G 3: 121,156,513 Y95H probably damaging Het
Scfd1 A G 12: 51,445,674 I589V possibly damaging Het
Sgsm1 A T 5: 113,286,838 I131N probably damaging Het
Tecpr1 A G 5: 144,211,421 S389P probably benign Het
Tle3 T A 9: 61,374,014 I29N probably damaging Het
Tmem63c C A 12: 87,057,197 N73K probably damaging Het
Tpm2 T A 4: 43,518,301 probably null Het
Trak2 A T 1: 58,911,812 D405E possibly damaging Het
Ttn C A 2: 76,745,172 A23380S probably damaging Het
Ttn A T 2: 76,885,151 probably benign Het
Tub T C 7: 109,029,650 S391P probably damaging Het
Ush2a G T 1: 188,267,026 E178* probably null Het
Wdr66 A G 5: 123,254,372 probably benign Het
Wisp3 T C 10: 39,158,300 Y102C probably damaging Het
Ylpm1 C A 12: 84,997,256 T256K unknown Het
Other mutations in Ccdc162
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01013:Ccdc162 APN 10 41581339 missense probably benign 0.01
IGL01366:Ccdc162 APN 10 41580306 missense possibly damaging 0.49
IGL01924:Ccdc162 APN 10 41569887 missense probably damaging 1.00
IGL02504:Ccdc162 APN 10 41552388 missense probably damaging 1.00
IGL02678:Ccdc162 APN 10 41561155 missense probably damaging 0.99
IGL02955:Ccdc162 APN 10 41561127 missense probably damaging 1.00
beeswax UTSW 10 41561226 missense possibly damaging 0.57
honeycomb UTSW 10 41644641 missense probably benign 0.35
FR4304:Ccdc162 UTSW 10 41556121 missense possibly damaging 0.49
R0432:Ccdc162 UTSW 10 41541860 missense probably benign 0.01
R0585:Ccdc162 UTSW 10 41586379 missense probably benign 0.03
R0645:Ccdc162 UTSW 10 41586411 splice site probably benign
R0731:Ccdc162 UTSW 10 41579143 missense probably damaging 1.00
R1426:Ccdc162 UTSW 10 41553182 missense possibly damaging 0.89
R1447:Ccdc162 UTSW 10 41580247 missense probably damaging 1.00
R1712:Ccdc162 UTSW 10 41539431 missense probably benign 0.35
R2138:Ccdc162 UTSW 10 41581297 missense probably benign 0.15
R2351:Ccdc162 UTSW 10 41555972 critical splice donor site probably null
R2394:Ccdc162 UTSW 10 41569898 missense probably damaging 1.00
R2431:Ccdc162 UTSW 10 41569845 missense probably benign
R2571:Ccdc162 UTSW 10 41552397 missense probably damaging 1.00
R2873:Ccdc162 UTSW 10 41655099 missense possibly damaging 0.68
R2926:Ccdc162 UTSW 10 41561207 start gained probably benign
R2999:Ccdc162 UTSW 10 41580290 missense probably benign 0.00
R3412:Ccdc162 UTSW 10 41539549 splice site probably benign
R3712:Ccdc162 UTSW 10 41587379 missense probably benign
R3736:Ccdc162 UTSW 10 41589568 intron probably null
R4112:Ccdc162 UTSW 10 41656328 missense possibly damaging 0.77
R4557:Ccdc162 UTSW 10 41587388 missense probably benign 0.01
R4580:Ccdc162 UTSW 10 41561140 missense probably benign 0.02
R4685:Ccdc162 UTSW 10 41681686 missense possibly damaging 0.89
R4837:Ccdc162 UTSW 10 41673867 missense probably benign 0.00
R5155:Ccdc162 UTSW 10 41553580 splice site probably null
R5155:Ccdc162 UTSW 10 41579151 missense probably damaging 1.00
R5645:Ccdc162 UTSW 10 41552356 missense probably benign 0.06
R5656:Ccdc162 UTSW 10 41569934 missense probably benign 0.26
R5682:Ccdc162 UTSW 10 41556803 nonsense probably null
R5808:Ccdc162 UTSW 10 41655504 missense possibly damaging 0.62
R5909:Ccdc162 UTSW 10 41561115 missense probably damaging 1.00
R6057:Ccdc162 UTSW 10 41634041 missense possibly damaging 0.72
R6211:Ccdc162 UTSW 10 41630145 nonsense probably null
R6264:Ccdc162 UTSW 10 41694468 missense probably benign 0.31
R6329:Ccdc162 UTSW 10 41663151 missense possibly damaging 0.76
R6349:Ccdc162 UTSW 10 41694400 missense probably damaging 0.97
R6398:Ccdc162 UTSW 10 41627149 missense probably damaging 1.00
R6453:Ccdc162 UTSW 10 41550825 missense probably damaging 1.00
R6602:Ccdc162 UTSW 10 41615980 missense probably benign 0.00
R6627:Ccdc162 UTSW 10 41663185 missense probably damaging 1.00
R6722:Ccdc162 UTSW 10 41644641 missense probably benign 0.35
R6750:Ccdc162 UTSW 10 41561226 missense possibly damaging 0.57
R6968:Ccdc162 UTSW 10 41673844 missense possibly damaging 0.55
R6970:Ccdc162 UTSW 10 41615958 missense probably benign 0.03
R6989:Ccdc162 UTSW 10 41581353 missense probably damaging 0.99
R7008:Ccdc162 UTSW 10 41552415 missense probably damaging 1.00
R7135:Ccdc162 UTSW 10 41673859 missense probably benign 0.00
R7139:Ccdc162 UTSW 10 41666721 missense possibly damaging 0.49
R7224:Ccdc162 UTSW 10 41561191 missense probably damaging 1.00
R7230:Ccdc162 UTSW 10 41678813 missense probably damaging 1.00
R7256:Ccdc162 UTSW 10 41556001 missense probably damaging 0.99
R7261:Ccdc162 UTSW 10 41561140 missense probably benign 0.02
R7390:Ccdc162 UTSW 10 41634048 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCCCTCAGGTTTGGCATAAGAAC -3'
(R):5'- CAGTCAAGGGTTCAGTGTTGAG -3'

Sequencing Primer
(F):5'- CAGGTTTGGCATAAGAACATCTCTCC -3'
(R):5'- TGAGCCAAAGCAACGTGTTC -3'
Posted On2017-06-26