Incidental Mutation 'R6001:Stat4'
ID 480816
Institutional Source Beutler Lab
Gene Symbol Stat4
Ensembl Gene ENSMUSG00000062939
Gene Name signal transducer and activator of transcription 4
Synonyms
MMRRC Submission 044180-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.317) question?
Stock # R6001 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 52026307-52146348 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 52136026 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Valine at position 445 (E445V)
Ref Sequence ENSEMBL: ENSMUSP00000130713 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027277] [ENSMUST00000168302]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000027277
AA Change: E445V

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000027277
Gene: ENSMUSG00000062939
AA Change: E445V

DomainStartEndE-ValueType
STAT_int 2 122 3.73e-60 SMART
Pfam:STAT_alpha 140 314 2.2e-54 PFAM
Pfam:STAT_bind 316 562 4.7e-76 PFAM
SH2 571 681 9.07e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000168302
AA Change: E445V

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000130713
Gene: ENSMUSG00000062939
AA Change: E445V

DomainStartEndE-ValueType
STAT_int 2 122 3.73e-60 SMART
Pfam:STAT_alpha 137 314 8.2e-66 PFAM
Pfam:STAT_bind 316 563 3.3e-114 PFAM
SH2 571 681 9.07e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185516
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the STAT family of transcription factors. In response to cytokines and growth factors, STAT family members are phosphorylated by the receptor associated kinases, and then form homo- or heterodimers that translocate to the cell nucleus where they act as transcription activators. Homozygous knockout mice for this gene exhibit reduced inflammation and cytokine production in response to immune challenge. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygous inactivation of this gene leads to altered cytokine production of T-cells, impaired IL-12 responses, enhanced Th2 cell development, decreased susceptibility to autoimmune diabetes, altered NK cell responses during viral infection, and increased susceptibility to Salmonella infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 G T 4: 53,075,555 (GRCm39) R999S possibly damaging Het
Ankrd31 T A 13: 96,962,717 (GRCm39) Y503N probably damaging Het
Anks4b A G 7: 119,781,941 (GRCm39) E324G probably benign Het
Arhgap44 CTGCT CTGCTTGCT 11: 64,922,910 (GRCm39) probably null Het
Atl1 A T 12: 69,979,057 (GRCm39) T162S possibly damaging Het
Atp2b2 A G 6: 113,770,728 (GRCm39) Y394H probably damaging Het
Dennd2d A G 3: 106,399,776 (GRCm39) H233R probably benign Het
Dhx16 G T 17: 36,194,766 (GRCm39) M462I probably damaging Het
Hif3a T C 7: 16,784,486 (GRCm39) Y253C probably damaging Het
Hsf4 G A 8: 105,999,541 (GRCm39) G277R possibly damaging Het
Impg1 T C 9: 80,223,454 (GRCm39) D754G probably benign Het
Keap1 T C 9: 21,142,135 (GRCm39) S580G possibly damaging Het
Lrp6 T C 6: 134,441,481 (GRCm39) K1162E probably benign Het
Lrrc31 C T 3: 30,745,318 (GRCm39) V110I possibly damaging Het
Muc5b G T 7: 141,426,118 (GRCm39) K4738N possibly damaging Het
Myo1a G T 10: 127,542,794 (GRCm39) probably null Het
Odad2 T C 18: 7,286,838 (GRCm39) D131G probably benign Het
Or10q1b A G 19: 13,682,424 (GRCm39) T78A probably damaging Het
Or52z14 T A 7: 103,253,179 (GRCm39) M106K probably damaging Het
Or7g19 A T 9: 18,856,340 (GRCm39) Y132F probably damaging Het
Parp4 A T 14: 56,878,740 (GRCm39) H1225L probably benign Het
Pcgf2 T C 11: 97,583,606 (GRCm39) Y52C possibly damaging Het
Pkn3 T C 2: 29,978,596 (GRCm39) probably null Het
Psen2 C A 1: 180,073,234 (GRCm39) R29L possibly damaging Het
Rfx6 A G 10: 51,594,307 (GRCm39) probably null Het
Rps13 T C 7: 115,930,808 (GRCm39) T145A probably benign Het
Rsf1 G A 7: 97,229,117 (GRCm39) probably benign Het
Rsf1 GCG GCGACG 7: 97,229,114 (GRCm39) probably benign Het
Rsf1 A ACGGCGACGG 7: 97,229,111 (GRCm39) probably null Het
Smarca4 C T 9: 21,544,205 (GRCm39) probably benign Het
Taf13 T A 3: 108,488,387 (GRCm39) I90N probably damaging Het
Tas2r124 T A 6: 132,732,416 (GRCm39) Y242N probably damaging Het
Tmem151b T C 17: 45,856,711 (GRCm39) Y243C probably damaging Het
Wasl T C 6: 24,619,573 (GRCm39) T316A unknown Het
Zbtb44 T C 9: 30,965,090 (GRCm39) C167R probably damaging Het
Zc3h7b T C 15: 81,676,236 (GRCm39) L714P possibly damaging Het
Zfp35 T A 18: 24,135,816 (GRCm39) H53Q probably benign Het
Zfp804b A G 5: 6,819,043 (GRCm39) V1340A probably benign Het
Other mutations in Stat4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Stat4 APN 1 52,142,037 (GRCm39) missense probably damaging 1.00
IGL00482:Stat4 APN 1 52,113,856 (GRCm39) missense probably benign 0.05
IGL01395:Stat4 APN 1 52,051,033 (GRCm39) missense probably damaging 1.00
IGL01533:Stat4 APN 1 52,137,578 (GRCm39) missense probably damaging 1.00
IGL01943:Stat4 APN 1 52,136,014 (GRCm39) missense possibly damaging 0.94
IGL02114:Stat4 APN 1 52,142,024 (GRCm39) missense probably damaging 1.00
IGL02151:Stat4 APN 1 52,053,029 (GRCm39) missense probably damaging 0.99
IGL02601:Stat4 APN 1 52,137,574 (GRCm39) missense probably damaging 1.00
R0016:Stat4 UTSW 1 52,107,939 (GRCm39) missense probably benign 0.01
R0243:Stat4 UTSW 1 52,051,016 (GRCm39) missense probably benign 0.22
R0329:Stat4 UTSW 1 52,130,029 (GRCm39) intron probably benign
R0973:Stat4 UTSW 1 52,135,979 (GRCm39) missense probably damaging 0.99
R1144:Stat4 UTSW 1 52,123,288 (GRCm39) splice site probably benign
R1187:Stat4 UTSW 1 52,115,836 (GRCm39) missense probably damaging 1.00
R1331:Stat4 UTSW 1 52,053,086 (GRCm39) missense probably benign 0.20
R1401:Stat4 UTSW 1 52,111,106 (GRCm39) splice site probably benign
R1529:Stat4 UTSW 1 52,050,952 (GRCm39) missense probably damaging 1.00
R1711:Stat4 UTSW 1 52,146,084 (GRCm39) missense probably damaging 1.00
R2213:Stat4 UTSW 1 52,053,014 (GRCm39) missense probably damaging 0.98
R3003:Stat4 UTSW 1 52,142,145 (GRCm39) missense probably damaging 1.00
R3683:Stat4 UTSW 1 52,052,981 (GRCm39) missense possibly damaging 0.89
R3789:Stat4 UTSW 1 52,050,955 (GRCm39) missense probably benign 0.07
R3919:Stat4 UTSW 1 52,135,981 (GRCm39) missense possibly damaging 0.62
R4320:Stat4 UTSW 1 52,113,866 (GRCm39) missense probably benign
R4373:Stat4 UTSW 1 52,111,100 (GRCm39) critical splice donor site probably null
R5024:Stat4 UTSW 1 52,121,729 (GRCm39) missense possibly damaging 0.80
R5103:Stat4 UTSW 1 52,111,054 (GRCm39) missense probably damaging 0.97
R5206:Stat4 UTSW 1 52,144,395 (GRCm39) missense probably damaging 0.99
R5944:Stat4 UTSW 1 52,113,898 (GRCm39) missense probably damaging 1.00
R5961:Stat4 UTSW 1 52,104,543 (GRCm39) missense possibly damaging 0.50
R6161:Stat4 UTSW 1 52,113,836 (GRCm39) missense possibly damaging 0.94
R6262:Stat4 UTSW 1 52,141,360 (GRCm39) missense probably null 1.00
R6701:Stat4 UTSW 1 52,142,133 (GRCm39) missense probably damaging 1.00
R6767:Stat4 UTSW 1 52,115,742 (GRCm39) missense probably benign 0.00
R6989:Stat4 UTSW 1 52,107,974 (GRCm39) missense probably benign 0.09
R7507:Stat4 UTSW 1 52,117,733 (GRCm39) missense probably damaging 1.00
R7539:Stat4 UTSW 1 52,110,868 (GRCm39) splice site probably null
R7546:Stat4 UTSW 1 52,137,622 (GRCm39) missense probably damaging 0.98
R7616:Stat4 UTSW 1 52,053,037 (GRCm39) nonsense probably null
R7751:Stat4 UTSW 1 52,121,711 (GRCm39) missense possibly damaging 0.73
R8052:Stat4 UTSW 1 52,118,932 (GRCm39) missense probably damaging 1.00
R8311:Stat4 UTSW 1 52,142,075 (GRCm39) missense probably damaging 1.00
R8419:Stat4 UTSW 1 52,137,637 (GRCm39) missense possibly damaging 0.89
R8679:Stat4 UTSW 1 52,118,991 (GRCm39) missense probably null 1.00
R8699:Stat4 UTSW 1 52,111,096 (GRCm39) missense probably benign
R8738:Stat4 UTSW 1 52,115,711 (GRCm39) missense possibly damaging 0.95
R8921:Stat4 UTSW 1 52,144,892 (GRCm39) missense probably benign 0.39
R9013:Stat4 UTSW 1 52,050,957 (GRCm39) missense probably benign 0.00
R9237:Stat4 UTSW 1 52,146,073 (GRCm39) missense probably benign
R9729:Stat4 UTSW 1 52,141,762 (GRCm39) missense possibly damaging 0.94
R9767:Stat4 UTSW 1 52,141,653 (GRCm39) missense probably damaging 1.00
Z1177:Stat4 UTSW 1 52,137,644 (GRCm39) missense probably null 1.00
Z1177:Stat4 UTSW 1 52,123,258 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGGAAACTGAAAGTCATTCTTTGCC -3'
(R):5'- GTTGAATTCACAAGAGTCATGGAG -3'

Sequencing Primer
(F):5'- AAATACTGTGAAACTTTGGGGTC -3'
(R):5'- CACAAGAGTCATGGAGTCTTTATC -3'
Posted On 2017-06-26