Incidental Mutation 'R6001:Stat4'
ID480816
Institutional Source Beutler Lab
Gene Symbol Stat4
Ensembl Gene ENSMUSG00000062939
Gene Namesignal transducer and activator of transcription 4
Synonyms
MMRRC Submission 044180-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.466) question?
Stock #R6001 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location51987148-52107189 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 52096867 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 445 (E445V)
Ref Sequence ENSEMBL: ENSMUSP00000130713 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027277] [ENSMUST00000168302]
Predicted Effect probably damaging
Transcript: ENSMUST00000027277
AA Change: E445V

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000027277
Gene: ENSMUSG00000062939
AA Change: E445V

DomainStartEndE-ValueType
STAT_int 2 122 3.73e-60 SMART
Pfam:STAT_alpha 140 314 2.2e-54 PFAM
Pfam:STAT_bind 316 562 4.7e-76 PFAM
SH2 571 681 9.07e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000168302
AA Change: E445V

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000130713
Gene: ENSMUSG00000062939
AA Change: E445V

DomainStartEndE-ValueType
STAT_int 2 122 3.73e-60 SMART
Pfam:STAT_alpha 137 314 8.2e-66 PFAM
Pfam:STAT_bind 316 563 3.3e-114 PFAM
SH2 571 681 9.07e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185516
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the STAT family of transcription factors. In response to cytokines and growth factors, STAT family members are phosphorylated by the receptor associated kinases, and then form homo- or heterodimers that translocate to the cell nucleus where they act as transcription activators. Homozygous knockout mice for this gene exhibit reduced inflammation and cytokine production in response to immune challenge. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygous inactivation of this gene leads to altered cytokine production of T-cells, impaired IL-12 responses, enhanced Th2 cell development, decreased susceptibility to autoimmune diabetes, altered NK cell responses during viral infection, and increased susceptibility to Salmonella infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 G T 4: 53,075,555 R999S possibly damaging Het
Ankrd31 T A 13: 96,826,209 Y503N probably damaging Het
Anks4b A G 7: 120,182,718 E324G probably benign Het
Arhgap44 CTGCT CTGCTTGCT 11: 65,032,084 probably null Het
Armc4 T C 18: 7,286,838 D131G probably benign Het
Atl1 A T 12: 69,932,283 T162S possibly damaging Het
Atp2b2 A G 6: 113,793,767 Y394H probably damaging Het
Dennd2d A G 3: 106,492,460 H233R probably benign Het
Dhx16 G T 17: 35,883,874 M462I probably damaging Het
Hif3a T C 7: 17,050,561 Y253C probably damaging Het
Hsf4 G A 8: 105,272,909 G277R possibly damaging Het
Impg1 T C 9: 80,316,172 D754G probably benign Het
Keap1 T C 9: 21,230,839 S580G possibly damaging Het
Lrp6 T C 6: 134,464,518 K1162E probably benign Het
Lrrc31 C T 3: 30,691,169 V110I possibly damaging Het
Muc5b G T 7: 141,872,381 K4738N possibly damaging Het
Myo1a G T 10: 127,706,925 probably null Het
Olfr1491 A G 19: 13,705,060 T78A probably damaging Het
Olfr619 T A 7: 103,603,972 M106K probably damaging Het
Olfr832 A T 9: 18,945,044 Y132F probably damaging Het
Parp4 A T 14: 56,641,283 H1225L probably benign Het
Pcgf2 T C 11: 97,692,780 Y52C possibly damaging Het
Pkn3 T C 2: 30,088,584 probably null Het
Psen2 C A 1: 180,245,669 R29L possibly damaging Het
Rfx6 A G 10: 51,718,211 probably null Het
Rps13 T C 7: 116,331,573 T145A probably benign Het
Rsf1 A ACGGCGACGG 7: 97,579,904 probably null Het
Rsf1 GCG GCGACG 7: 97,579,907 probably benign Het
Rsf1 G A 7: 97,579,910 probably benign Het
Smarca4 C T 9: 21,632,909 probably benign Het
Taf13 T A 3: 108,581,071 I90N probably damaging Het
Tas2r124 T A 6: 132,755,453 Y242N probably damaging Het
Tmem151b T C 17: 45,545,785 Y243C probably damaging Het
Wasl T C 6: 24,619,574 T316A unknown Het
Zbtb44 T C 9: 31,053,794 C167R probably damaging Het
Zc3h7b T C 15: 81,792,035 L714P possibly damaging Het
Zfp35 T A 18: 24,002,759 H53Q probably benign Het
Zfp804b A G 5: 6,769,043 V1340A probably benign Het
Other mutations in Stat4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Stat4 APN 1 52102878 missense probably damaging 1.00
IGL00482:Stat4 APN 1 52074697 missense probably benign 0.05
IGL01395:Stat4 APN 1 52011874 missense probably damaging 1.00
IGL01533:Stat4 APN 1 52098419 missense probably damaging 1.00
IGL01943:Stat4 APN 1 52096855 missense possibly damaging 0.94
IGL02114:Stat4 APN 1 52102865 missense probably damaging 1.00
IGL02151:Stat4 APN 1 52013870 missense probably damaging 0.99
IGL02601:Stat4 APN 1 52098415 missense probably damaging 1.00
R0016:Stat4 UTSW 1 52068780 missense probably benign 0.01
R0243:Stat4 UTSW 1 52011857 missense probably benign 0.22
R0329:Stat4 UTSW 1 52090870 intron probably benign
R0973:Stat4 UTSW 1 52096820 missense probably damaging 0.99
R1144:Stat4 UTSW 1 52084129 splice site probably benign
R1187:Stat4 UTSW 1 52076677 missense probably damaging 1.00
R1331:Stat4 UTSW 1 52013927 missense probably benign 0.20
R1401:Stat4 UTSW 1 52071947 splice site probably benign
R1529:Stat4 UTSW 1 52011793 missense probably damaging 1.00
R1711:Stat4 UTSW 1 52106925 missense probably damaging 1.00
R2213:Stat4 UTSW 1 52013855 missense probably damaging 0.98
R3003:Stat4 UTSW 1 52102986 missense probably damaging 1.00
R3683:Stat4 UTSW 1 52013822 missense possibly damaging 0.89
R3789:Stat4 UTSW 1 52011796 missense probably benign 0.07
R3919:Stat4 UTSW 1 52096822 missense possibly damaging 0.62
R4320:Stat4 UTSW 1 52074707 missense probably benign
R4373:Stat4 UTSW 1 52071941 critical splice donor site probably null
R5024:Stat4 UTSW 1 52082570 missense possibly damaging 0.80
R5103:Stat4 UTSW 1 52071895 missense probably damaging 0.97
R5206:Stat4 UTSW 1 52105236 missense probably damaging 0.99
R5944:Stat4 UTSW 1 52074739 missense probably damaging 1.00
R5961:Stat4 UTSW 1 52065384 missense possibly damaging 0.50
R6161:Stat4 UTSW 1 52074677 missense possibly damaging 0.94
R6262:Stat4 UTSW 1 52102201 missense probably null 1.00
R6701:Stat4 UTSW 1 52102974 missense probably damaging 1.00
R6767:Stat4 UTSW 1 52076583 missense probably benign 0.00
R6989:Stat4 UTSW 1 52068815 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TGGAAACTGAAAGTCATTCTTTGCC -3'
(R):5'- GTTGAATTCACAAGAGTCATGGAG -3'

Sequencing Primer
(F):5'- AAATACTGTGAAACTTTGGGGTC -3'
(R):5'- CACAAGAGTCATGGAGTCTTTATC -3'
Posted On2017-06-26