Incidental Mutation 'R6001:Impg1'
ID480841
Institutional Source Beutler Lab
Gene Symbol Impg1
Ensembl Gene ENSMUSG00000032343
Gene Nameinterphotoreceptor matrix proteoglycan 1
SynonymsIMP150, SPACR, A930015H12Rik
MMRRC Submission 044180-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R6001 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location80313330-80465481 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 80316172 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 754 (D754G)
Ref Sequence ENSEMBL: ENSMUSP00000108876 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035889] [ENSMUST00000076140] [ENSMUST00000085289] [ENSMUST00000113250] [ENSMUST00000113266] [ENSMUST00000113268]
Predicted Effect probably benign
Transcript: ENSMUST00000035889
SMART Domains Protein: ENSMUSP00000036181
Gene: ENSMUSG00000033577

DomainStartEndE-ValueType
MYSc 51 772 N/A SMART
IQ 812 834 8.58e-1 SMART
low complexity region 909 980 N/A INTRINSIC
low complexity region 982 1002 N/A INTRINSIC
Blast:MYSc 1003 1113 3e-29 BLAST
PDB:3H8D|D 1134 1262 1e-74 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000076140
SMART Domains Protein: ENSMUSP00000075501
Gene: ENSMUSG00000033577

DomainStartEndE-ValueType
MYSc 51 772 N/A SMART
IQ 812 834 8.58e-1 SMART
low complexity region 909 980 N/A INTRINSIC
low complexity region 982 1002 N/A INTRINSIC
Blast:MYSc 1003 1126 2e-27 BLAST
PDB:3H8D|D 1138 1266 8e-75 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000085289
AA Change: D677G

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000082395
Gene: ENSMUSG00000032343
AA Change: D677G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
SEA 158 273 8.68e-1 SMART
low complexity region 353 374 N/A INTRINSIC
SEA 494 616 1.37e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113250
AA Change: D754G

PolyPhen 2 Score 0.116 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000108876
Gene: ENSMUSG00000032343
AA Change: D754G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
SEA 235 350 8.68e-1 SMART
low complexity region 430 451 N/A INTRINSIC
SEA 571 693 1.37e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113266
SMART Domains Protein: ENSMUSP00000108891
Gene: ENSMUSG00000033577

DomainStartEndE-ValueType
MYSc 51 772 N/A SMART
IQ 812 834 8.58e-1 SMART
low complexity region 909 980 N/A INTRINSIC
low complexity region 982 1002 N/A INTRINSIC
Blast:MYSc 1003 1113 3e-29 BLAST
PDB:3H8D|D 1125 1253 9e-75 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000113268
SMART Domains Protein: ENSMUSP00000108893
Gene: ENSMUSG00000033577

DomainStartEndE-ValueType
MYSc 51 772 N/A SMART
IQ 812 834 8.58e-1 SMART
low complexity region 909 980 N/A INTRINSIC
low complexity region 982 1002 N/A INTRINSIC
Blast:MYSc 1003 1135 2e-26 BLAST
Pfam:Myosin-VI_CBD 1167 1257 1.4e-46 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is a major component of the retinal interphotoreceptor matrix. The encoded protein is a proteoglycan that is thought to play a role in maintaining viability of photoreceptor cells and in adhesion of the neural retina to the retinal pigment epithelium. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 G T 4: 53,075,555 R999S possibly damaging Het
Ankrd31 T A 13: 96,826,209 Y503N probably damaging Het
Anks4b A G 7: 120,182,718 E324G probably benign Het
Arhgap44 CTGCT CTGCTTGCT 11: 65,032,084 probably null Het
Armc4 T C 18: 7,286,838 D131G probably benign Het
Atl1 A T 12: 69,932,283 T162S possibly damaging Het
Atp2b2 A G 6: 113,793,767 Y394H probably damaging Het
Dennd2d A G 3: 106,492,460 H233R probably benign Het
Dhx16 G T 17: 35,883,874 M462I probably damaging Het
Hif3a T C 7: 17,050,561 Y253C probably damaging Het
Hsf4 G A 8: 105,272,909 G277R possibly damaging Het
Keap1 T C 9: 21,230,839 S580G possibly damaging Het
Lrp6 T C 6: 134,464,518 K1162E probably benign Het
Lrrc31 C T 3: 30,691,169 V110I possibly damaging Het
Muc5b G T 7: 141,872,381 K4738N possibly damaging Het
Myo1a G T 10: 127,706,925 probably null Het
Olfr1491 A G 19: 13,705,060 T78A probably damaging Het
Olfr619 T A 7: 103,603,972 M106K probably damaging Het
Olfr832 A T 9: 18,945,044 Y132F probably damaging Het
Parp4 A T 14: 56,641,283 H1225L probably benign Het
Pcgf2 T C 11: 97,692,780 Y52C possibly damaging Het
Pkn3 T C 2: 30,088,584 probably null Het
Psen2 C A 1: 180,245,669 R29L possibly damaging Het
Rfx6 A G 10: 51,718,211 probably null Het
Rps13 T C 7: 116,331,573 T145A probably benign Het
Rsf1 GCG GCGACG 7: 97,579,907 probably benign Het
Rsf1 G A 7: 97,579,910 probably benign Het
Rsf1 A ACGGCGACGG 7: 97,579,904 probably null Het
Smarca4 C T 9: 21,632,909 probably benign Het
Stat4 A T 1: 52,096,867 E445V probably damaging Het
Taf13 T A 3: 108,581,071 I90N probably damaging Het
Tas2r124 T A 6: 132,755,453 Y242N probably damaging Het
Tmem151b T C 17: 45,545,785 Y243C probably damaging Het
Wasl T C 6: 24,619,574 T316A unknown Het
Zbtb44 T C 9: 31,053,794 C167R probably damaging Het
Zc3h7b T C 15: 81,792,035 L714P possibly damaging Het
Zfp35 T A 18: 24,002,759 H53Q probably benign Het
Zfp804b A G 5: 6,769,043 V1340A probably benign Het
Other mutations in Impg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Impg1 APN 9 80322829 missense probably benign 0.02
IGL01733:Impg1 APN 9 80341924 missense probably damaging 0.99
IGL02333:Impg1 APN 9 80440755 missense possibly damaging 0.74
IGL03097:Impg1 UTSW 9 80379952 missense possibly damaging 0.48
R0021:Impg1 UTSW 9 80435426 missense probably damaging 1.00
R0029:Impg1 UTSW 9 80398371 missense probably damaging 1.00
R0029:Impg1 UTSW 9 80398371 missense probably damaging 1.00
R0108:Impg1 UTSW 9 80322848 missense possibly damaging 0.63
R0201:Impg1 UTSW 9 80345561 missense probably damaging 1.00
R0271:Impg1 UTSW 9 80386879 splice site probably benign
R0316:Impg1 UTSW 9 80342065 missense probably damaging 1.00
R0492:Impg1 UTSW 9 80345308 missense possibly damaging 0.74
R0633:Impg1 UTSW 9 80394155 missense possibly damaging 0.72
R0705:Impg1 UTSW 9 80379979 missense probably damaging 1.00
R0962:Impg1 UTSW 9 80381741 missense probably benign 0.23
R1264:Impg1 UTSW 9 80314393 missense probably benign 0.31
R1707:Impg1 UTSW 9 80378517 splice site probably null
R2017:Impg1 UTSW 9 80440667 missense probably damaging 1.00
R3904:Impg1 UTSW 9 80345585 missense possibly damaging 0.76
R3960:Impg1 UTSW 9 80440864 missense probably benign 0.00
R4231:Impg1 UTSW 9 80345329 missense probably damaging 1.00
R4233:Impg1 UTSW 9 80345329 missense probably damaging 1.00
R4235:Impg1 UTSW 9 80345329 missense probably damaging 1.00
R4236:Impg1 UTSW 9 80345329 missense probably damaging 1.00
R4490:Impg1 UTSW 9 80394059 missense probably damaging 1.00
R4592:Impg1 UTSW 9 80440854 missense probably benign 0.05
R4701:Impg1 UTSW 9 80314400 missense probably benign 0.07
R4785:Impg1 UTSW 9 80398450 missense probably benign 0.01
R4796:Impg1 UTSW 9 80394095 missense probably damaging 0.99
R4923:Impg1 UTSW 9 80345078 nonsense probably null
R4923:Impg1 UTSW 9 80345545 missense probably damaging 0.98
R5468:Impg1 UTSW 9 80465265 missense probably benign 0.05
R5596:Impg1 UTSW 9 80345218 missense probably benign 0.24
R6156:Impg1 UTSW 9 80322824 missense probably damaging 1.00
R6315:Impg1 UTSW 9 80394074 missense probably benign 0.21
R6419:Impg1 UTSW 9 80380018 missense probably benign 0.38
R6880:Impg1 UTSW 9 80404800 missense probably damaging 1.00
R7013:Impg1 UTSW 9 80378494 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGGTGCTTTATGTAGCCC -3'
(R):5'- CCACCCTTTTGCATGACAAG -3'

Sequencing Primer
(F):5'- GCCCCTTTAAAAATGTTAAAAAGCGC -3'
(R):5'- TTTGCATGACAAGCTCACCC -3'
Posted On2017-06-26