Incidental Mutation 'R6001:Ankrd31'
ID480846
Institutional Source Beutler Lab
Gene Symbol Ankrd31
Ensembl Gene ENSMUSG00000109561
Gene Nameankyrin repeat domain 31
Synonyms
MMRRC Submission 044180-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.434) question?
Stock #R6001 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location96748272-96910039 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 96826209 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 503 (Y503N)
Ref Sequence ENSEMBL: ENSMUSP00000146720 (fasta)
Predicted Effect unknown
Transcript: ENSMUST00000207464
AA Change: Y353N
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208004
Predicted Effect probably damaging
Transcript: ENSMUST00000208758
AA Change: Y503N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 G T 4: 53,075,555 R999S possibly damaging Het
Anks4b A G 7: 120,182,718 E324G probably benign Het
Arhgap44 CTGCT CTGCTTGCT 11: 65,032,084 probably null Het
Armc4 T C 18: 7,286,838 D131G probably benign Het
Atl1 A T 12: 69,932,283 T162S possibly damaging Het
Atp2b2 A G 6: 113,793,767 Y394H probably damaging Het
Dennd2d A G 3: 106,492,460 H233R probably benign Het
Dhx16 G T 17: 35,883,874 M462I probably damaging Het
Hif3a T C 7: 17,050,561 Y253C probably damaging Het
Hsf4 G A 8: 105,272,909 G277R possibly damaging Het
Impg1 T C 9: 80,316,172 D754G probably benign Het
Keap1 T C 9: 21,230,839 S580G possibly damaging Het
Lrp6 T C 6: 134,464,518 K1162E probably benign Het
Lrrc31 C T 3: 30,691,169 V110I possibly damaging Het
Muc5b G T 7: 141,872,381 K4738N possibly damaging Het
Myo1a G T 10: 127,706,925 probably null Het
Olfr1491 A G 19: 13,705,060 T78A probably damaging Het
Olfr619 T A 7: 103,603,972 M106K probably damaging Het
Olfr832 A T 9: 18,945,044 Y132F probably damaging Het
Parp4 A T 14: 56,641,283 H1225L probably benign Het
Pcgf2 T C 11: 97,692,780 Y52C possibly damaging Het
Pkn3 T C 2: 30,088,584 probably null Het
Psen2 C A 1: 180,245,669 R29L possibly damaging Het
Rfx6 A G 10: 51,718,211 probably null Het
Rps13 T C 7: 116,331,573 T145A probably benign Het
Rsf1 A ACGGCGACGG 7: 97,579,904 probably null Het
Rsf1 GCG GCGACG 7: 97,579,907 probably benign Het
Rsf1 G A 7: 97,579,910 probably benign Het
Smarca4 C T 9: 21,632,909 probably benign Het
Stat4 A T 1: 52,096,867 E445V probably damaging Het
Taf13 T A 3: 108,581,071 I90N probably damaging Het
Tas2r124 T A 6: 132,755,453 Y242N probably damaging Het
Tmem151b T C 17: 45,545,785 Y243C probably damaging Het
Wasl T C 6: 24,619,574 T316A unknown Het
Zbtb44 T C 9: 31,053,794 C167R probably damaging Het
Zc3h7b T C 15: 81,792,035 L714P possibly damaging Het
Zfp35 T A 18: 24,002,759 H53Q probably benign Het
Zfp804b A G 5: 6,769,043 V1340A probably benign Het
Other mutations in Ankrd31
AlleleSourceChrCoordTypePredicted EffectPPH Score
R6035:Ankrd31 UTSW 13 96832213 missense probably benign 0.00
R6035:Ankrd31 UTSW 13 96832213 missense probably benign 0.00
R6273:Ankrd31 UTSW 13 96851673 missense possibly damaging 0.61
R6291:Ankrd31 UTSW 13 96878238 missense possibly damaging 0.72
R6387:Ankrd31 UTSW 13 96830573 missense probably damaging 0.99
R6608:Ankrd31 UTSW 13 96832780 missense probably damaging 0.99
R6680:Ankrd31 UTSW 13 96830609 critical splice donor site probably null
R6738:Ankrd31 UTSW 13 96904127 missense possibly damaging 0.79
R6860:Ankrd31 UTSW 13 96831586 missense probably benign 0.01
R6988:Ankrd31 UTSW 13 96878249 missense probably damaging 1.00
R7305:Ankrd31 UTSW 13 96878971 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTTTAAAGTTATGTGCTAGCCCAC -3'
(R):5'- GGTCCTTTTCTTATGTACAATTGCG -3'

Sequencing Primer
(F):5'- TATGAGTGGAGCTGATCC -3'
(R):5'- CTTATGTACAATTGCGAACAAGC -3'
Posted On2017-06-26