Incidental Mutation 'R0514:Plch2'
ID48090
Institutional Source Beutler Lab
Gene Symbol Plch2
Ensembl Gene ENSMUSG00000029055
Gene Namephospholipase C, eta 2
SynonymsPlcl4, A930027K05Rik, PLCeta2
MMRRC Submission 038708-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0514 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location154983115-155056784 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 154998886 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 431 (S431P)
Ref Sequence ENSEMBL: ENSMUSP00000134750 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105631] [ENSMUST00000135665] [ENSMUST00000139976] [ENSMUST00000145662] [ENSMUST00000176194] [ENSMUST00000186598]
Predicted Effect probably damaging
Transcript: ENSMUST00000105631
AA Change: S532P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101256
Gene: ENSMUSG00000029055
AA Change: S532P

DomainStartEndE-ValueType
low complexity region 28 45 N/A INTRINSIC
low complexity region 96 107 N/A INTRINSIC
PH 122 231 1.8e-6 SMART
EFh 247 275 7.29e-4 SMART
EFh 283 312 4.67e-2 SMART
Pfam:EF-hand_like 317 399 1.7e-26 PFAM
PLCXc 400 545 6.76e-76 SMART
low complexity region 559 572 N/A INTRINSIC
low complexity region 659 676 N/A INTRINSIC
PLCYc 707 821 1.25e-56 SMART
C2 840 948 1.66e-21 SMART
low complexity region 1088 1107 N/A INTRINSIC
low complexity region 1227 1236 N/A INTRINSIC
low complexity region 1356 1369 N/A INTRINSIC
low complexity region 1421 1451 N/A INTRINSIC
low complexity region 1454 1466 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127661
Predicted Effect probably damaging
Transcript: ENSMUST00000135665
AA Change: S427P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118292
Gene: ENSMUSG00000029055
AA Change: S427P

DomainStartEndE-ValueType
PH 17 126 1.8e-6 SMART
EFh 142 170 7.29e-4 SMART
EFh 178 207 4.67e-2 SMART
Pfam:EF-hand_like 212 294 2.8e-25 PFAM
PLCXc 295 440 6.76e-76 SMART
low complexity region 454 467 N/A INTRINSIC
low complexity region 554 571 N/A INTRINSIC
PLCYc 602 716 1.25e-56 SMART
C2 735 843 1.66e-21 SMART
low complexity region 983 1002 N/A INTRINSIC
low complexity region 1122 1131 N/A INTRINSIC
low complexity region 1251 1264 N/A INTRINSIC
low complexity region 1316 1346 N/A INTRINSIC
low complexity region 1349 1361 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000139976
AA Change: S532P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122704
Gene: ENSMUSG00000029055
AA Change: S532P

DomainStartEndE-ValueType
low complexity region 28 45 N/A INTRINSIC
low complexity region 96 107 N/A INTRINSIC
PH 122 231 1.8e-6 SMART
EFh 247 275 7.29e-4 SMART
EFh 283 312 4.67e-2 SMART
Pfam:EF-hand_like 317 399 3.2e-27 PFAM
PLCXc 400 545 6.76e-76 SMART
low complexity region 559 572 N/A INTRINSIC
low complexity region 659 676 N/A INTRINSIC
PLCYc 707 821 1.25e-56 SMART
C2 840 948 1.66e-21 SMART
low complexity region 1087 1100 N/A INTRINSIC
low complexity region 1166 1194 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000145662
AA Change: S456P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119864
Gene: ENSMUSG00000029055
AA Change: S456P

DomainStartEndE-ValueType
PH 46 155 1.8e-6 SMART
EFh 171 199 7.29e-4 SMART
EFh 207 236 4.67e-2 SMART
Pfam:EF-hand_like 241 323 5.2e-27 PFAM
PLCXc 324 469 6.76e-76 SMART
low complexity region 483 496 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000175982
AA Change: S316P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000176194
AA Change: S431P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134750
Gene: ENSMUSG00000029055
AA Change: S431P

DomainStartEndE-ValueType
PH 21 130 1.8e-6 SMART
EFh 146 174 7.29e-4 SMART
EFh 182 211 4.67e-2 SMART
Pfam:EF-hand_like 216 298 1.6e-25 PFAM
PLCXc 299 444 6.76e-76 SMART
low complexity region 458 471 N/A INTRINSIC
low complexity region 558 575 N/A INTRINSIC
PLCYc 606 720 1.25e-56 SMART
C2 739 847 1.66e-21 SMART
low complexity region 986 999 N/A INTRINSIC
low complexity region 1065 1093 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186598
SMART Domains Protein: ENSMUSP00000141152
Gene: ENSMUSG00000029055

DomainStartEndE-ValueType
C2 79 189 5.8e-18 SMART
low complexity region 328 341 N/A INTRINSIC
low complexity region 407 435 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PLCH2 is a member of the PLC-eta family of the phosphoinositide-specific phospholipase C (PLC) superfamily of enzymes that cleave PtdIns(4,5) P2 to generate second messengers inositol 1,4,5-trisphosphate and diacylglycerol (Zhou et al., 2005 [PubMed 16107206]).[supplied by OMIM, Jun 2009]
PHENOTYPE: Mice homozygous for a reporter allele exhibit no apparent abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acpp T A 9: 104,319,978 Y154F probably damaging Het
Acsl6 A T 11: 54,350,580 D579V probably damaging Het
Adamts18 C T 8: 113,738,769 probably null Het
Adamts20 A T 15: 94,270,376 V1882D probably damaging Het
Add3 A T 19: 53,236,843 K465* probably null Het
Ago1 T G 4: 126,439,595 I524L probably benign Het
Akr1c18 A G 13: 4,137,191 M208T probably benign Het
Anapc1 C A 2: 128,632,655 L1413F probably damaging Het
Arid4b A T 13: 14,184,317 D646V probably damaging Het
Arnt2 T C 7: 84,304,859 E261G probably benign Het
Bccip C T 7: 133,719,130 T211I possibly damaging Het
Bsn T C 9: 108,125,782 S475G probably benign Het
Cdh26 G A 2: 178,466,828 probably null Het
Ceacam2 A G 7: 25,520,931 F414S probably benign Het
Cfb T C 17: 34,860,898 R172G probably damaging Het
Cntnap5b A C 1: 99,772,786 T8P probably benign Het
Cpne9 A T 6: 113,290,013 I136L probably damaging Het
Crtc1 A T 8: 70,402,429 probably null Het
Dcdc2a A T 13: 25,119,386 H300L probably benign Het
Dhdh C T 7: 45,488,706 V20M probably benign Het
Dhx34 T C 7: 16,210,537 Q584R probably benign Het
Dis3l2 A G 1: 87,047,092 Y701C probably damaging Het
Dmrt2 T C 19: 25,675,655 probably null Het
Dnah5 A G 15: 28,366,321 T2727A probably damaging Het
Dopey1 A G 9: 86,520,734 E1329G probably damaging Het
Evpl A G 11: 116,223,291 V1191A probably damaging Het
Fam198a A G 9: 121,978,352 T521A possibly damaging Het
Fgfr1op A G 17: 8,191,434 N342S possibly damaging Het
Fhl4 T C 10: 85,098,386 D177G probably damaging Het
Heg1 A G 16: 33,726,756 T662A possibly damaging Het
Ifih1 A G 2: 62,623,391 probably null Het
Il13 T C 11: 53,632,518 R87G possibly damaging Het
Kcnc3 T A 7: 44,595,928 Y547* probably null Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Lama1 G A 17: 67,764,698 G860D probably benign Het
Lmo7 T C 14: 101,887,173 L356P probably damaging Het
Lmo7 A T 14: 101,896,559 K447I probably damaging Het
Lrp2bp A G 8: 46,011,958 H38R probably damaging Het
Magi3 G A 3: 104,015,022 P1460S probably damaging Het
Megf8 T A 7: 25,364,303 C2695S possibly damaging Het
Mrgprb2 T G 7: 48,551,970 S336R probably benign Het
Mrgprx2 C T 7: 48,482,964 M1I probably null Het
Mug2 T C 6: 122,081,599 L1320P probably damaging Het
Noxred1 A G 12: 87,227,064 S68P probably benign Het
Olfr504 T A 7: 108,565,672 Y41F probably damaging Het
Olfr561 T A 7: 102,775,332 H269Q probably benign Het
Os9 C T 10: 127,119,639 C123Y probably damaging Het
Ostf1 T A 19: 18,596,359 T42S probably benign Het
Parg C A 14: 32,254,560 T186K possibly damaging Het
Pcnx T A 12: 81,995,110 M2172K probably benign Het
Pip4k2a A G 2: 18,845,936 I360T probably damaging Het
Pkn2 T C 3: 142,810,458 D568G possibly damaging Het
Prl8a6 A T 13: 27,433,007 C233* probably null Het
Prox1 G A 1: 190,161,456 T264I probably damaging Het
Prr5 A G 15: 84,702,766 N248S probably benign Het
Psip1 A C 4: 83,460,037 S407R probably damaging Het
Rab32 A T 10: 10,550,896 V102E probably damaging Het
Rap1gap2 T G 11: 74,388,854 K687Q possibly damaging Het
Rbak A T 5: 143,173,414 V628E probably damaging Het
Rnf148 T C 6: 23,654,793 E68G possibly damaging Het
Rnf212 A T 5: 108,749,442 S3T probably damaging Het
Rrad T G 8: 104,628,627 I250L probably benign Het
Sall4 T C 2: 168,755,705 H405R probably damaging Het
Scn9a T C 2: 66,483,678 R1888G probably damaging Het
Setd5 G T 6: 113,119,437 E535* probably null Het
Slc20a1 C T 2: 129,199,891 S58L probably damaging Het
Slc31a1 A G 4: 62,385,604 probably benign Het
Slc38a11 G T 2: 65,316,865 Q423K probably benign Het
Snrpd1 A T 18: 10,626,846 T38S possibly damaging Het
Taar4 A G 10: 23,960,882 D130G probably damaging Het
Tfb2m C T 1: 179,531,304 R338H probably benign Het
Tm2d2 A G 8: 25,022,726 I197V possibly damaging Het
Tmem132a C T 19: 10,858,991 G725D probably damaging Het
Tmem67 T C 4: 12,089,317 T38A probably benign Het
Tmprss15 A T 16: 78,968,267 S816T probably benign Het
Tnfrsf11a A G 1: 105,826,992 E263G probably damaging Het
Tnfrsf17 C T 16: 11,315,327 L90F probably benign Het
Tpr A G 1: 150,402,273 K117E possibly damaging Het
Trim43a C T 9: 88,584,336 Q5* probably null Het
Ubn1 A T 16: 5,073,071 D498V probably damaging Het
Vipr1 T A 9: 121,658,049 C63S probably damaging Het
Vmn1r237 T A 17: 21,314,670 H218Q possibly damaging Het
Vmn2r100 C A 17: 19,522,120 P252Q possibly damaging Het
Vmn2r95 T C 17: 18,451,582 V527A probably benign Het
Vmn2r97 A T 17: 18,914,472 T51S probably benign Het
Vwa8 G A 14: 78,947,189 V376I probably benign Het
Wdfy4 T A 14: 33,080,775 T1838S probably benign Het
Zcwpw1 A T 5: 137,796,683 E47V probably benign Het
Zeb2 T C 2: 45,002,647 E130G possibly damaging Het
Zfp111 A G 7: 24,199,143 Y348H probably damaging Het
Zfp53 T C 17: 21,509,009 S435P probably damaging Het
Other mutations in Plch2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Plch2 APN 4 155006642 missense probably damaging 1.00
IGL02024:Plch2 APN 4 155043138 intron probably benign
IGL02580:Plch2 APN 4 154984764 missense probably benign 0.03
IGL03370:Plch2 APN 4 154986914 missense probably benign 0.18
IGL03407:Plch2 APN 4 154989798 missense probably damaging 1.00
tolerant UTSW 4 154984635 missense probably benign 0.01
PIT4418001:Plch2 UTSW 4 154989503 missense probably damaging 1.00
PIT4445001:Plch2 UTSW 4 155009026 missense probably damaging 1.00
R0117:Plch2 UTSW 4 154985358 unclassified probably benign
R0347:Plch2 UTSW 4 154986721 missense possibly damaging 0.91
R0361:Plch2 UTSW 4 155006711 missense possibly damaging 0.95
R0413:Plch2 UTSW 4 155006916 critical splice donor site probably null
R0487:Plch2 UTSW 4 155009012 missense probably damaging 1.00
R0734:Plch2 UTSW 4 154996283 missense probably damaging 1.00
R0766:Plch2 UTSW 4 154989799 missense probably damaging 1.00
R1306:Plch2 UTSW 4 155007140 missense probably damaging 1.00
R1312:Plch2 UTSW 4 154989799 missense probably damaging 1.00
R1467:Plch2 UTSW 4 154983732 missense probably benign 0.02
R1467:Plch2 UTSW 4 154983732 missense probably benign 0.02
R1602:Plch2 UTSW 4 154984450 missense probably damaging 0.99
R1717:Plch2 UTSW 4 154998272 missense probably benign
R1731:Plch2 UTSW 4 155006994 missense possibly damaging 0.83
R1769:Plch2 UTSW 4 155000083 missense probably damaging 1.00
R1875:Plch2 UTSW 4 154998508 missense probably damaging 1.00
R1974:Plch2 UTSW 4 154984953 missense possibly damaging 0.77
R2031:Plch2 UTSW 4 155043027 intron probably benign
R2050:Plch2 UTSW 4 155000818 missense probably benign 0.00
R2061:Plch2 UTSW 4 155042841 intron probably benign
R2073:Plch2 UTSW 4 154989909 missense probably damaging 1.00
R2075:Plch2 UTSW 4 154989909 missense probably damaging 1.00
R2109:Plch2 UTSW 4 154984597 missense possibly damaging 0.92
R2126:Plch2 UTSW 4 154998999 missense probably damaging 1.00
R2265:Plch2 UTSW 4 154993004 missense probably benign 0.06
R2266:Plch2 UTSW 4 154993004 missense probably benign 0.06
R2269:Plch2 UTSW 4 154993004 missense probably benign 0.06
R2280:Plch2 UTSW 4 154984309 missense probably damaging 1.00
R2281:Plch2 UTSW 4 154984309 missense probably damaging 1.00
R2432:Plch2 UTSW 4 154986164 makesense probably null
R2971:Plch2 UTSW 4 154990767 missense probably benign 0.29
R3437:Plch2 UTSW 4 154991013 critical splice donor site probably null
R3980:Plch2 UTSW 4 154984798 missense probably benign 0.00
R4757:Plch2 UTSW 4 154996233 missense possibly damaging 0.88
R4827:Plch2 UTSW 4 154991113 missense probably damaging 1.00
R4828:Plch2 UTSW 4 154984635 missense probably benign 0.01
R4869:Plch2 UTSW 4 154989428 missense probably benign 0.28
R5020:Plch2 UTSW 4 155007083 missense probably damaging 1.00
R5050:Plch2 UTSW 4 155043309 intron probably benign
R5126:Plch2 UTSW 4 155000519 missense probably damaging 1.00
R5237:Plch2 UTSW 4 155010794 missense probably benign
R5274:Plch2 UTSW 4 154998954 missense probably damaging 1.00
R5296:Plch2 UTSW 4 154989999 intron probably null
R5324:Plch2 UTSW 4 154984534 missense probably benign
R5475:Plch2 UTSW 4 155000137 missense probably damaging 1.00
R5494:Plch2 UTSW 4 154991122 missense probably damaging 1.00
R5811:Plch2 UTSW 4 154992567 missense possibly damaging 0.62
R6083:Plch2 UTSW 4 155000818 missense probably benign 0.00
R6092:Plch2 UTSW 4 154984372 missense probably benign 0.02
R6253:Plch2 UTSW 4 155007101 missense probably damaging 1.00
R6456:Plch2 UTSW 4 154993002 missense probably damaging 1.00
R7038:Plch2 UTSW 4 154990032 intron probably null
R7084:Plch2 UTSW 4 154986991 missense probably benign 0.31
R7210:Plch2 UTSW 4 155009086 missense probably damaging 1.00
R7216:Plch2 UTSW 4 154984228 missense probably benign
R7264:Plch2 UTSW 4 154998967 missense probably damaging 0.98
R7291:Plch2 UTSW 4 154998472 missense probably damaging 1.00
R7423:Plch2 UTSW 4 154983737 missense probably damaging 1.00
R7436:Plch2 UTSW 4 154984096 missense probably benign 0.01
R7438:Plch2 UTSW 4 155000460 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACTGTCCTCATCAGATACTTCGC -3'
(R):5'- CACAGTCAATGGTACAGATGGCCTG -3'

Sequencing Primer
(F):5'- TCTTGGAACTCCAGGCCAC -3'
(R):5'- GGTACAGATGGCCTGTATACCTAC -3'
Posted On2013-06-12