Incidental Mutation 'R5993:Sema3e'
ID480938
Institutional Source Beutler Lab
Gene Symbol Sema3e
Ensembl Gene ENSMUSG00000063531
Gene Namesema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3E
SynonymsSemah
MMRRC Submission 044172-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.482) question?
Stock #R5993 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location14025276-14256689 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 14224293 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 186 (E186G)
Ref Sequence ENSEMBL: ENSMUSP00000073612 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073957]
Predicted Effect probably damaging
Transcript: ENSMUST00000073957
AA Change: E186G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000073612
Gene: ENSMUSG00000063531
AA Change: E186G

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Sema 58 500 1.85e-194 SMART
PSI 518 573 1.81e-10 SMART
IG 587 673 5.75e-4 SMART
low complexity region 737 750 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130116
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.3%
  • 20x: 91.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Semaphorins are a large family of conserved secreted and membrane associated proteins which possess a semaphorin (Sema) domain and a PSI domain (found in plexins, semaphorins and integrins) in the N-terminal extracellular portion. Based on sequence and structural similarities, semaphorins are put into eight classes: invertebrates contain classes 1 and 2, viruses have class V, and vertebrates contain classes 3-7. Semaphorins serve as axon guidance ligands via multimeric receptor complexes, some (if not all) containing plexin proteins. This gene encodes a class 4 semaphorin. This gene encodes a class 3 semaphorin. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, May 2010]
PHENOTYPE: Homozygous null mice display abnormal intersomitic vacular development and loss of the normal segmented somite pattern. Homozygous mutants for another allele have Bergmeister papillae on the surface of the optic disc. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts20 G T 15: 94,338,723 N805K probably damaging Het
Add1 A C 5: 34,601,533 S64R probably damaging Het
Akap2 A G 4: 57,855,273 K444E possibly damaging Het
Alas1 A G 9: 106,234,129 F613L probably benign Het
Ankrd17 A T 5: 90,339,672 probably benign Het
Anks3 C T 16: 4,958,137 G67D probably damaging Het
Aspm C T 1: 139,479,531 T2052I probably benign Het
Atp8b4 C T 2: 126,403,234 V332I probably benign Het
Bin2 CGGAGCTGA C 15: 100,645,020 probably null Het
Bpifb3 T A 2: 153,929,314 M382K probably benign Het
Ccdc149 C T 5: 52,402,775 R246Q probably damaging Het
Ccdc57 T C 11: 120,894,724 K462E possibly damaging Het
Cux1 T C 5: 136,363,271 T9A probably benign Het
Cyp2c23 A G 19: 44,012,360 Y362H probably damaging Het
D430041D05Rik A G 2: 104,168,067 I998T probably damaging Het
Dclre1a A C 19: 56,542,737 Y726D probably damaging Het
Dnah5 T C 15: 28,299,226 V1578A probably benign Het
Dppa4 C T 16: 48,289,346 R110* probably null Het
Drc7 T A 8: 95,074,192 V614E probably benign Het
Fam71d C A 12: 78,715,436 N12K probably damaging Het
Gcc1 G A 6: 28,424,852 probably null Het
Greb1l G A 18: 10,544,455 D1350N probably benign Het
Kcnc1 G A 7: 46,427,532 V253M probably damaging Het
Krt78 T A 15: 101,950,449 I323F probably damaging Het
Man2b2 A G 5: 36,820,980 V320A probably benign Het
Mphosph9 A T 5: 124,316,098 F112Y probably benign Het
Mrc1 A G 2: 14,305,327 T800A probably damaging Het
Mroh1 C A 15: 76,446,680 A1197E probably damaging Het
Nlrp10 A T 7: 108,927,013 H39Q probably benign Het
Nop2 C T 6: 125,144,019 T588I probably benign Het
Oxld1 A G 11: 120,457,009 S121P probably benign Het
Prox1 T A 1: 190,162,239 D3V probably damaging Het
Ptk7 T C 17: 46,565,370 T1052A probably benign Het
Rhot2 T A 17: 25,841,111 T299S probably benign Het
Rhov A G 2: 119,270,052 F235L probably damaging Het
Runx1t1 A T 4: 13,841,863 R158S probably damaging Het
Runx1t1 A T 4: 13,875,490 E431D probably benign Het
Sema5b T A 16: 35,646,202 L158H probably damaging Het
Serpina3j A G 12: 104,314,687 T40A probably benign Het
Shroom3 A T 5: 92,940,188 S185C probably damaging Het
Skint6 A T 4: 112,809,079 V1183D probably benign Het
Smg1 A G 7: 118,140,509 V3405A probably benign Het
Supt16 C A 14: 52,178,334 R357L probably damaging Het
Thrap3 A T 4: 126,175,460 probably null Het
Topaz1 T C 9: 122,749,039 L338S probably benign Het
Ttll3 T A 6: 113,398,031 Y139* probably null Het
Ttn T G 2: 76,795,907 D6641A probably damaging Het
Wwc1 T C 11: 35,852,336 D886G probably benign Het
Zc3h7a T A 16: 11,150,662 K484N probably damaging Het
Other mutations in Sema3e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Sema3e APN 5 14240572 missense probably damaging 1.00
IGL01068:Sema3e APN 5 14233718 critical splice donor site probably null
IGL01128:Sema3e APN 5 14232115 missense probably damaging 1.00
IGL01134:Sema3e APN 5 14252770 missense probably damaging 1.00
IGL02013:Sema3e APN 5 14230193 missense probably damaging 1.00
IGL02051:Sema3e APN 5 14224310 missense possibly damaging 0.77
IGL02309:Sema3e APN 5 14224390 missense probably damaging 0.98
IGL02636:Sema3e APN 5 14225656 missense probably benign
IGL02702:Sema3e APN 5 14233726 splice site probably benign
IGL03001:Sema3e APN 5 14241043 missense probably benign 0.19
R0011:Sema3e UTSW 5 14144011 nonsense probably null
R0098:Sema3e UTSW 5 14252432 missense possibly damaging 0.52
R0098:Sema3e UTSW 5 14252432 missense possibly damaging 0.52
R0220:Sema3e UTSW 5 14164153 missense possibly damaging 0.56
R0564:Sema3e UTSW 5 14236085 critical splice donor site probably null
R1079:Sema3e UTSW 5 14225655 missense probably benign 0.12
R1187:Sema3e UTSW 5 14232084 missense probably damaging 1.00
R1670:Sema3e UTSW 5 14162185 splice site probably benign
R1736:Sema3e UTSW 5 14210376 missense probably damaging 1.00
R3433:Sema3e UTSW 5 14252714 missense probably benign 0.00
R3831:Sema3e UTSW 5 14226482 missense probably damaging 1.00
R4094:Sema3e UTSW 5 14233690 missense probably benign 0.12
R4580:Sema3e UTSW 5 14233703 missense probably damaging 1.00
R4828:Sema3e UTSW 5 14226640 missense probably damaging 1.00
R4855:Sema3e UTSW 5 14230130 missense probably damaging 0.99
R4884:Sema3e UTSW 5 14225565 missense probably damaging 1.00
R4960:Sema3e UTSW 5 14252632 missense possibly damaging 0.93
R5264:Sema3e UTSW 5 14226648 missense probably damaging 1.00
R5389:Sema3e UTSW 5 14236085 critical splice donor site probably benign
R5512:Sema3e UTSW 5 14230180 missense probably damaging 1.00
R5642:Sema3e UTSW 5 14162243 missense probably damaging 1.00
R5647:Sema3e UTSW 5 14225553 missense probably damaging 0.99
R5814:Sema3e UTSW 5 14225666 missense probably benign 0.01
R6076:Sema3e UTSW 5 14241086 missense probably benign 0.01
R6906:Sema3e UTSW 5 14240587 missense probably damaging 1.00
X0064:Sema3e UTSW 5 14230142 missense probably benign 0.05
Z1088:Sema3e UTSW 5 14226456 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TAACACTGAGTGCTGCGTTTTC -3'
(R):5'- ACAGACTCAGTCATGGACCG -3'

Sequencing Primer
(F):5'- GTTCAGAAAGAAATGGCTCCC -3'
(R):5'- TCAGTCATGGACCGTAGACTC -3'
Posted On2017-06-26