Incidental Mutation 'R5993:Add1'
ID480939
Institutional Source Beutler Lab
Gene Symbol Add1
Ensembl Gene ENSMUSG00000029106
Gene Nameadducin 1 (alpha)
Synonyms
MMRRC Submission 044172-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.929) question?
Stock #R5993 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location34573664-34632308 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 34601533 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 64 (S64R)
Ref Sequence ENSEMBL: ENSMUSP00000116075 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001108] [ENSMUST00000052836] [ENSMUST00000114335] [ENSMUST00000114338] [ENSMUST00000114340] [ENSMUST00000146295] [ENSMUST00000147574]
Predicted Effect probably damaging
Transcript: ENSMUST00000001108
AA Change: S64R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000001108
Gene: ENSMUSG00000029106
AA Change: S64R

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Aldolase_II 147 329 5.49e-58 SMART
coiled coil region 599 631 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000052836
AA Change: S64R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000052266
Gene: ENSMUSG00000029106
AA Change: S64R

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Aldolase_II 147 329 5.49e-58 SMART
coiled coil region 599 631 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114335
AA Change: S64R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109974
Gene: ENSMUSG00000029106
AA Change: S64R

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Aldolase_II 147 329 5.49e-58 SMART
coiled coil region 597 629 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114338
AA Change: S64R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109977
Gene: ENSMUSG00000029106
AA Change: S64R

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Aldolase_II 147 329 5.49e-58 SMART
coiled coil region 568 600 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114340
AA Change: S64R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109979
Gene: ENSMUSG00000029106
AA Change: S64R

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Aldolase_II 147 329 5.49e-58 SMART
coiled coil region 568 600 N/A INTRINSIC
low complexity region 666 685 N/A INTRINSIC
low complexity region 698 719 N/A INTRINSIC
low complexity region 727 733 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145986
Predicted Effect probably damaging
Transcript: ENSMUST00000146295
AA Change: S64R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118539
Gene: ENSMUSG00000029106
AA Change: S64R

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Blast:Aldolase_II 102 140 1e-19 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000147574
AA Change: S64R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116075
Gene: ENSMUSG00000029106
AA Change: S64R

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Blast:Aldolase_II 102 140 1e-19 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201368
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.3%
  • 20x: 91.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adducins are a family of cytoskeleton proteins encoded by three genes (alpha, beta, gamma). Adducin is a heterodimeric protein that consists of related subunits, which are produced from distinct genes but share a similar structure. Alpha- and beta-adducin include a protease-resistant N-terminal region and a protease-sensitive, hydrophilic C-terminal region. Alpha- and gamma-adducins are ubiquitously expressed. In contrast, beta-adducin is expressed at high levels in brain and hematopoietic tissues. Adducin binds with high affinity to Ca(2+)/calmodulin and is a substrate for protein kinases A and C. Alternative splicing results in multiple variants encoding distinct isoforms; however, not all variants have been fully described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted gene deletion leads to reduced growth and compensated hemolytic anemia. RBCs are osmotically fragile, dehydrated, and spherocytic with severe loss of membrane surface area and reduced MCV. ~50% of homozygotes develop lethal hydrocephaly with dilation of the lateral, 3rd, and 4th ventricles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts20 G T 15: 94,338,723 N805K probably damaging Het
Akap2 A G 4: 57,855,273 K444E possibly damaging Het
Alas1 A G 9: 106,234,129 F613L probably benign Het
Ankrd17 A T 5: 90,339,672 probably benign Het
Anks3 C T 16: 4,958,137 G67D probably damaging Het
Aspm C T 1: 139,479,531 T2052I probably benign Het
Atp8b4 C T 2: 126,403,234 V332I probably benign Het
Bin2 CGGAGCTGA C 15: 100,645,020 probably null Het
Bpifb3 T A 2: 153,929,314 M382K probably benign Het
Ccdc149 C T 5: 52,402,775 R246Q probably damaging Het
Ccdc57 T C 11: 120,894,724 K462E possibly damaging Het
Cux1 T C 5: 136,363,271 T9A probably benign Het
Cyp2c23 A G 19: 44,012,360 Y362H probably damaging Het
D430041D05Rik A G 2: 104,168,067 I998T probably damaging Het
Dclre1a A C 19: 56,542,737 Y726D probably damaging Het
Dnah5 T C 15: 28,299,226 V1578A probably benign Het
Dppa4 C T 16: 48,289,346 R110* probably null Het
Drc7 T A 8: 95,074,192 V614E probably benign Het
Fam71d C A 12: 78,715,436 N12K probably damaging Het
Gcc1 G A 6: 28,424,852 probably null Het
Greb1l G A 18: 10,544,455 D1350N probably benign Het
Kcnc1 G A 7: 46,427,532 V253M probably damaging Het
Krt78 T A 15: 101,950,449 I323F probably damaging Het
Man2b2 A G 5: 36,820,980 V320A probably benign Het
Mphosph9 A T 5: 124,316,098 F112Y probably benign Het
Mrc1 A G 2: 14,305,327 T800A probably damaging Het
Mroh1 C A 15: 76,446,680 A1197E probably damaging Het
Nlrp10 A T 7: 108,927,013 H39Q probably benign Het
Nop2 C T 6: 125,144,019 T588I probably benign Het
Oxld1 A G 11: 120,457,009 S121P probably benign Het
Prox1 T A 1: 190,162,239 D3V probably damaging Het
Ptk7 T C 17: 46,565,370 T1052A probably benign Het
Rhot2 T A 17: 25,841,111 T299S probably benign Het
Rhov A G 2: 119,270,052 F235L probably damaging Het
Runx1t1 A T 4: 13,841,863 R158S probably damaging Het
Runx1t1 A T 4: 13,875,490 E431D probably benign Het
Sema3e A G 5: 14,224,293 E186G probably damaging Het
Sema5b T A 16: 35,646,202 L158H probably damaging Het
Serpina3j A G 12: 104,314,687 T40A probably benign Het
Shroom3 A T 5: 92,940,188 S185C probably damaging Het
Skint6 A T 4: 112,809,079 V1183D probably benign Het
Smg1 A G 7: 118,140,509 V3405A probably benign Het
Supt16 C A 14: 52,178,334 R357L probably damaging Het
Thrap3 A T 4: 126,175,460 probably null Het
Topaz1 T C 9: 122,749,039 L338S probably benign Het
Ttll3 T A 6: 113,398,031 Y139* probably null Het
Ttn T G 2: 76,795,907 D6641A probably damaging Het
Wwc1 T C 11: 35,852,336 D886G probably benign Het
Zc3h7a T A 16: 11,150,662 K484N probably damaging Het
Other mutations in Add1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00781:Add1 APN 5 34613358 missense probably damaging 1.00
IGL01370:Add1 APN 5 34630515 missense probably damaging 1.00
IGL01670:Add1 APN 5 34620063 missense probably damaging 1.00
IGL02965:Add1 APN 5 34620123 missense probably damaging 0.99
IGL03178:Add1 APN 5 34614245 unclassified probably null
R0126:Add1 UTSW 5 34613579 missense probably benign 0.04
R0189:Add1 UTSW 5 34616648 missense probably benign 0.01
R0195:Add1 UTSW 5 34610646 unclassified probably benign
R0318:Add1 UTSW 5 34625340 missense probably damaging 0.99
R0605:Add1 UTSW 5 34614224 missense possibly damaging 0.87
R0624:Add1 UTSW 5 34605853 missense probably damaging 1.00
R1514:Add1 UTSW 5 34610617 missense probably benign 0.03
R1573:Add1 UTSW 5 34601396 missense possibly damaging 0.89
R2512:Add1 UTSW 5 34616686 missense probably benign 0.02
R2965:Add1 UTSW 5 34630714 missense probably benign 0.00
R2966:Add1 UTSW 5 34630714 missense probably benign 0.00
R5646:Add1 UTSW 5 34630680 missense probably benign 0.10
R6356:Add1 UTSW 5 34619396 missense probably null 1.00
R6514:Add1 UTSW 5 34605973 missense probably damaging 1.00
R6536:Add1 UTSW 5 34601436 missense possibly damaging 0.89
R6659:Add1 UTSW 5 34613295 missense possibly damaging 0.94
R7326:Add1 UTSW 5 34619371 missense probably benign 0.32
R7473:Add1 UTSW 5 34619353 missense possibly damaging 0.84
Z1088:Add1 UTSW 5 34613400 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCCTAGGAAAATTGTGCAATGAATG -3'
(R):5'- TGGACCAACAGTGAAGACAGTTC -3'

Sequencing Primer
(F):5'- AAAATTGTGCAATGAATGGTGAC -3'
(R):5'- AATCTTCTAGTTATGTCTGCTAACAC -3'
Posted On2017-06-26