Incidental Mutation 'R5993:Fam71d'
ID480957
Institutional Source Beutler Lab
Gene Symbol Fam71d
Ensembl Gene ENSMUSG00000056987
Gene Namefamily with sequence similarity 71, member D
Synonyms
MMRRC Submission 044172-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R5993 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location78691535-78734516 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 78715436 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 12 (N12K)
Ref Sequence ENSEMBL: ENSMUSP00000151673 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077968] [ENSMUST00000219507] [ENSMUST00000219551] [ENSMUST00000220101] [ENSMUST00000220396]
Predicted Effect probably benign
Transcript: ENSMUST00000077968
AA Change: N291K

PolyPhen 2 Score 0.091 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000077119
Gene: ENSMUSG00000056987
AA Change: N291K

DomainStartEndE-ValueType
low complexity region 1 13 N/A INTRINSIC
Pfam:DUF3699 111 184 1.6e-25 PFAM
low complexity region 237 250 N/A INTRINSIC
low complexity region 265 284 N/A INTRINSIC
low complexity region 391 402 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000219507
Predicted Effect probably benign
Transcript: ENSMUST00000219551
AA Change: N291K

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219572
Predicted Effect probably damaging
Transcript: ENSMUST00000220101
AA Change: N12K

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000220212
Predicted Effect probably benign
Transcript: ENSMUST00000220396
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.3%
  • 20x: 91.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts20 G T 15: 94,338,723 N805K probably damaging Het
Add1 A C 5: 34,601,533 S64R probably damaging Het
Akap2 A G 4: 57,855,273 K444E possibly damaging Het
Alas1 A G 9: 106,234,129 F613L probably benign Het
Ankrd17 A T 5: 90,339,672 probably benign Het
Anks3 C T 16: 4,958,137 G67D probably damaging Het
Aspm C T 1: 139,479,531 T2052I probably benign Het
Atp8b4 C T 2: 126,403,234 V332I probably benign Het
Bin2 CGGAGCTGA C 15: 100,645,020 probably null Het
Bpifb3 T A 2: 153,929,314 M382K probably benign Het
Ccdc149 C T 5: 52,402,775 R246Q probably damaging Het
Ccdc57 T C 11: 120,894,724 K462E possibly damaging Het
Cux1 T C 5: 136,363,271 T9A probably benign Het
Cyp2c23 A G 19: 44,012,360 Y362H probably damaging Het
D430041D05Rik A G 2: 104,168,067 I998T probably damaging Het
Dclre1a A C 19: 56,542,737 Y726D probably damaging Het
Dnah5 T C 15: 28,299,226 V1578A probably benign Het
Dppa4 C T 16: 48,289,346 R110* probably null Het
Drc7 T A 8: 95,074,192 V614E probably benign Het
Gcc1 G A 6: 28,424,852 probably null Het
Greb1l G A 18: 10,544,455 D1350N probably benign Het
Kcnc1 G A 7: 46,427,532 V253M probably damaging Het
Krt78 T A 15: 101,950,449 I323F probably damaging Het
Man2b2 A G 5: 36,820,980 V320A probably benign Het
Mphosph9 A T 5: 124,316,098 F112Y probably benign Het
Mrc1 A G 2: 14,305,327 T800A probably damaging Het
Mroh1 C A 15: 76,446,680 A1197E probably damaging Het
Nlrp10 A T 7: 108,927,013 H39Q probably benign Het
Nop2 C T 6: 125,144,019 T588I probably benign Het
Oxld1 A G 11: 120,457,009 S121P probably benign Het
Prox1 T A 1: 190,162,239 D3V probably damaging Het
Ptk7 T C 17: 46,565,370 T1052A probably benign Het
Rhot2 T A 17: 25,841,111 T299S probably benign Het
Rhov A G 2: 119,270,052 F235L probably damaging Het
Runx1t1 A T 4: 13,841,863 R158S probably damaging Het
Runx1t1 A T 4: 13,875,490 E431D probably benign Het
Sema3e A G 5: 14,224,293 E186G probably damaging Het
Sema5b T A 16: 35,646,202 L158H probably damaging Het
Serpina3j A G 12: 104,314,687 T40A probably benign Het
Shroom3 A T 5: 92,940,188 S185C probably damaging Het
Skint6 A T 4: 112,809,079 V1183D probably benign Het
Smg1 A G 7: 118,140,509 V3405A probably benign Het
Supt16 C A 14: 52,178,334 R357L probably damaging Het
Thrap3 A T 4: 126,175,460 probably null Het
Topaz1 T C 9: 122,749,039 L338S probably benign Het
Ttll3 T A 6: 113,398,031 Y139* probably null Het
Ttn T G 2: 76,795,907 D6641A probably damaging Het
Wwc1 T C 11: 35,852,336 D886G probably benign Het
Zc3h7a T A 16: 11,150,662 K484N probably damaging Het
Other mutations in Fam71d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02123:Fam71d APN 12 78734207 critical splice donor site probably null
IGL02738:Fam71d APN 12 78734215 splice site probably benign
R0760:Fam71d UTSW 12 78715153 missense probably damaging 1.00
R1832:Fam71d UTSW 12 78715506 unclassified probably benign
R1833:Fam71d UTSW 12 78715506 unclassified probably benign
R4335:Fam71d UTSW 12 78712232 missense possibly damaging 0.77
R4437:Fam71d UTSW 12 78715050 missense probably damaging 1.00
R4850:Fam71d UTSW 12 78715153 missense probably damaging 1.00
R5234:Fam71d UTSW 12 78715271 nonsense probably null
R5445:Fam71d UTSW 12 78715116 missense probably damaging 1.00
R5587:Fam71d UTSW 12 78715075 missense probably damaging 0.99
R5965:Fam71d UTSW 12 78710306 missense unknown
R6644:Fam71d UTSW 12 78715286 missense probably damaging 1.00
R6660:Fam71d UTSW 12 78715357 missense possibly damaging 0.88
R7052:Fam71d UTSW 12 78719402 missense probably benign 0.00
R7098:Fam71d UTSW 12 78719634 critical splice donor site probably null
R7189:Fam71d UTSW 12 78712208 missense probably benign 0.22
R7305:Fam71d UTSW 12 78715035 missense possibly damaging 0.85
U24488:Fam71d UTSW 12 78715037 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCTTTCAGAGAACTGCGG -3'
(R):5'- CTGTGAGTTGTTTCCACAGC -3'

Sequencing Primer
(F):5'- CATCATGGAAAGTGCAGACTTCTCAG -3'
(R):5'- CCACAGCATTTTCATCATGAGTG -3'
Posted On2017-06-26