Incidental Mutation 'R5993:Sema5b'
ID480968
Institutional Source Beutler Lab
Gene Symbol Sema5b
Ensembl Gene ENSMUSG00000052133
Gene Namesema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5B
SynonymsSemG, Semag, SemG
MMRRC Submission 044172-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5993 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location35541145-35664732 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 35646202 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 158 (L158H)
Ref Sequence ENSEMBL: ENSMUSP00000112536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050625] [ENSMUST00000120756]
Predicted Effect probably damaging
Transcript: ENSMUST00000050625
AA Change: L158H

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000057494
Gene: ENSMUSG00000052133
AA Change: L158H

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Sema 68 479 1.68e-174 SMART
PSI 497 544 9.18e-12 SMART
TSP1 609 662 3.34e-15 SMART
TSP1 667 713 3.42e-12 SMART
TSP1 798 850 1.58e-16 SMART
TSP1 855 907 2.45e-13 SMART
TSP1 910 957 1.02e-1 SMART
transmembrane domain 977 999 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120756
AA Change: L158H

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000112536
Gene: ENSMUSG00000052133
AA Change: L158H

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Sema 68 479 1.68e-174 SMART
PSI 497 544 9.18e-12 SMART
TSP1 609 662 3.34e-15 SMART
TSP1 667 742 7.61e-10 SMART
TSP1 827 879 1.58e-16 SMART
TSP1 884 936 2.45e-13 SMART
TSP1 939 986 1.02e-1 SMART
transmembrane domain 1006 1028 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133554
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.3%
  • 20x: 91.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the semaphorin protein family which regulates axon growth during development of the nervous system. The encoded protein has a characteristic Sema domain near the N-terminus, through which semaphorins bind to plexin, and five thrombospondin type 1 repeats in the C-terminal region of the protein. The protein product may be cleaved and exist as a secreted molecule (PMID: 19463192). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a null mutation display defects in neurite arborization of multiple retinal cell types. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts20 G T 15: 94,338,723 N805K probably damaging Het
Add1 A C 5: 34,601,533 S64R probably damaging Het
Akap2 A G 4: 57,855,273 K444E possibly damaging Het
Alas1 A G 9: 106,234,129 F613L probably benign Het
Ankrd17 A T 5: 90,339,672 probably benign Het
Anks3 C T 16: 4,958,137 G67D probably damaging Het
Aspm C T 1: 139,479,531 T2052I probably benign Het
Atp8b4 C T 2: 126,403,234 V332I probably benign Het
Bin2 CGGAGCTGA C 15: 100,645,020 probably null Het
Bpifb3 T A 2: 153,929,314 M382K probably benign Het
Ccdc149 C T 5: 52,402,775 R246Q probably damaging Het
Ccdc57 T C 11: 120,894,724 K462E possibly damaging Het
Cux1 T C 5: 136,363,271 T9A probably benign Het
Cyp2c23 A G 19: 44,012,360 Y362H probably damaging Het
D430041D05Rik A G 2: 104,168,067 I998T probably damaging Het
Dclre1a A C 19: 56,542,737 Y726D probably damaging Het
Dnah5 T C 15: 28,299,226 V1578A probably benign Het
Dppa4 C T 16: 48,289,346 R110* probably null Het
Drc7 T A 8: 95,074,192 V614E probably benign Het
Fam71d C A 12: 78,715,436 N12K probably damaging Het
Gcc1 G A 6: 28,424,852 probably null Het
Greb1l G A 18: 10,544,455 D1350N probably benign Het
Kcnc1 G A 7: 46,427,532 V253M probably damaging Het
Krt78 T A 15: 101,950,449 I323F probably damaging Het
Man2b2 A G 5: 36,820,980 V320A probably benign Het
Mphosph9 A T 5: 124,316,098 F112Y probably benign Het
Mrc1 A G 2: 14,305,327 T800A probably damaging Het
Mroh1 C A 15: 76,446,680 A1197E probably damaging Het
Nlrp10 A T 7: 108,927,013 H39Q probably benign Het
Nop2 C T 6: 125,144,019 T588I probably benign Het
Oxld1 A G 11: 120,457,009 S121P probably benign Het
Prox1 T A 1: 190,162,239 D3V probably damaging Het
Ptk7 T C 17: 46,565,370 T1052A probably benign Het
Rhot2 T A 17: 25,841,111 T299S probably benign Het
Rhov A G 2: 119,270,052 F235L probably damaging Het
Runx1t1 A T 4: 13,841,863 R158S probably damaging Het
Runx1t1 A T 4: 13,875,490 E431D probably benign Het
Sema3e A G 5: 14,224,293 E186G probably damaging Het
Serpina3j A G 12: 104,314,687 T40A probably benign Het
Shroom3 A T 5: 92,940,188 S185C probably damaging Het
Skint6 A T 4: 112,809,079 V1183D probably benign Het
Smg1 A G 7: 118,140,509 V3405A probably benign Het
Supt16 C A 14: 52,178,334 R357L probably damaging Het
Thrap3 A T 4: 126,175,460 probably null Het
Topaz1 T C 9: 122,749,039 L338S probably benign Het
Ttll3 T A 6: 113,398,031 Y139* probably null Het
Ttn T G 2: 76,795,907 D6641A probably damaging Het
Wwc1 T C 11: 35,852,336 D886G probably benign Het
Zc3h7a T A 16: 11,150,662 K484N probably damaging Het
Other mutations in Sema5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00901:Sema5b APN 16 35651315 missense probably damaging 1.00
IGL01584:Sema5b APN 16 35645423 missense probably damaging 1.00
IGL01859:Sema5b APN 16 35647109 missense possibly damaging 0.94
IGL02195:Sema5b APN 16 35660479 critical splice acceptor site probably null
IGL02346:Sema5b APN 16 35649755 missense probably damaging 1.00
IGL02850:Sema5b APN 16 35660515 missense probably benign 0.01
IGL03277:Sema5b APN 16 35651312 missense probably damaging 0.96
R0101:Sema5b UTSW 16 35663102 splice site probably benign
R0368:Sema5b UTSW 16 35628100 missense probably damaging 1.00
R0426:Sema5b UTSW 16 35646355 missense probably damaging 1.00
R0675:Sema5b UTSW 16 35660333 missense probably benign 0.00
R0905:Sema5b UTSW 16 35622631 missense probably benign 0.33
R1163:Sema5b UTSW 16 35628096 missense probably benign 0.19
R1195:Sema5b UTSW 16 35651660 missense probably null 0.94
R1195:Sema5b UTSW 16 35651660 missense probably null 0.94
R1666:Sema5b UTSW 16 35658482 missense probably benign 0.03
R1706:Sema5b UTSW 16 35649755 missense probably damaging 0.98
R1733:Sema5b UTSW 16 35646367 missense probably damaging 1.00
R1775:Sema5b UTSW 16 35660324 missense probably benign
R2215:Sema5b UTSW 16 35660215 missense probably damaging 1.00
R2844:Sema5b UTSW 16 35659931 missense probably damaging 0.98
R3086:Sema5b UTSW 16 35622723 missense probably benign
R3613:Sema5b UTSW 16 35660150 missense probably benign
R4774:Sema5b UTSW 16 35663182 missense probably damaging 1.00
R5743:Sema5b UTSW 16 35658476 missense probably damaging 1.00
R5856:Sema5b UTSW 16 35646386 nonsense probably null
R6248:Sema5b UTSW 16 35628007 splice site probably null
R6420:Sema5b UTSW 16 35663146 missense probably benign 0.08
R6795:Sema5b UTSW 16 35658571 nonsense probably null
R6825:Sema5b UTSW 16 35628007 splice site probably null
R7066:Sema5b UTSW 16 35651312 missense probably benign 0.26
R7244:Sema5b UTSW 16 35660545 missense probably benign
Z1088:Sema5b UTSW 16 35660590 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGTCTTACTCGAAATGTCCATTTG -3'
(R):5'- GTTATACTGGGCAGTGCGAAG -3'

Sequencing Primer
(F):5'- TTCAGTGGACGCTCCTGAAG -3'
(R):5'- GAAGCGGTGGCCCACTG -3'
Posted On2017-06-26