Incidental Mutation 'R5995:Supt20'
ID481049
Institutional Source Beutler Lab
Gene Symbol Supt20
Ensembl Gene ENSMUSG00000027751
Gene Namesuppressor of Ty 20
SynonymsFam48a, p38IP, D3Ertd300e, p38 interacting protein
MMRRC Submission 044174-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.948) question?
Stock #R5995 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location54692807-54728766 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 54709053 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 245 (S245P)
Ref Sequence ENSEMBL: ENSMUSP00000131454 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029315] [ENSMUST00000170552] [ENSMUST00000178832] [ENSMUST00000197502] [ENSMUST00000199652] [ENSMUST00000199655] [ENSMUST00000199674] [ENSMUST00000200439] [ENSMUST00000200441]
Predicted Effect probably benign
Transcript: ENSMUST00000029315
SMART Domains Protein: ENSMUSP00000029315
Gene: ENSMUSG00000027751

DomainStartEndE-ValueType
low complexity region 65 78 N/A INTRINSIC
low complexity region 107 159 N/A INTRINSIC
coiled coil region 201 230 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000170552
AA Change: S245P

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000131454
Gene: ENSMUSG00000027751
AA Change: S245P

DomainStartEndE-ValueType
Pfam:Spt20 63 229 6.8e-47 PFAM
low complexity region 425 441 N/A INTRINSIC
low complexity region 468 477 N/A INTRINSIC
low complexity region 488 502 N/A INTRINSIC
low complexity region 515 526 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178832
Predicted Effect probably benign
Transcript: ENSMUST00000197502
AA Change: S244P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000143750
Gene: ENSMUSG00000027751
AA Change: S244P

DomainStartEndE-ValueType
low complexity region 45 56 N/A INTRINSIC
Pfam:Spt20 62 227 1.9e-43 PFAM
low complexity region 424 440 N/A INTRINSIC
low complexity region 467 476 N/A INTRINSIC
low complexity region 487 501 N/A INTRINSIC
low complexity region 512 532 N/A INTRINSIC
low complexity region 574 587 N/A INTRINSIC
low complexity region 632 680 N/A INTRINSIC
coiled coil region 722 751 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198745
Predicted Effect probably benign
Transcript: ENSMUST00000199652
SMART Domains Protein: ENSMUSP00000142648
Gene: ENSMUSG00000027751

DomainStartEndE-ValueType
low complexity region 45 56 N/A INTRINSIC
Pfam:Spt20 59 181 1.2e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199655
SMART Domains Protein: ENSMUSP00000143520
Gene: ENSMUSG00000027751

DomainStartEndE-ValueType
low complexity region 45 56 N/A INTRINSIC
Pfam:Spt20 62 140 5.3e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199674
AA Change: S244P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000142948
Gene: ENSMUSG00000027751
AA Change: S244P

DomainStartEndE-ValueType
low complexity region 45 56 N/A INTRINSIC
Pfam:Spt20 59 227 3.3e-39 PFAM
low complexity region 424 442 N/A INTRINSIC
low complexity region 466 475 N/A INTRINSIC
low complexity region 486 500 N/A INTRINSIC
low complexity region 513 524 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200439
AA Change: S244P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000143059
Gene: ENSMUSG00000027751
AA Change: S244P

DomainStartEndE-ValueType
low complexity region 45 56 N/A INTRINSIC
Pfam:Spt20 59 227 2.7e-42 PFAM
low complexity region 424 440 N/A INTRINSIC
low complexity region 467 476 N/A INTRINSIC
low complexity region 487 501 N/A INTRINSIC
low complexity region 514 525 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200441
SMART Domains Protein: ENSMUSP00000143231
Gene: ENSMUSG00000027751

DomainStartEndE-ValueType
low complexity region 65 78 N/A INTRINSIC
low complexity region 123 171 N/A INTRINSIC
coiled coil region 213 242 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200450
Meta Mutation Damage Score 0.114 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.7%
Validation Efficiency 100% (56/56)
MGI Phenotype PHENOTYPE: The incompletely penetrant homozygous phenotype of a splice-site mutation may include retinal epithelium expansion over the dorsal half of the eye, exencephaly, spina bifida, gastrulation defects and/or aberrant somite and mesoderm development. A few mutants survive postnatally and appear normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb8 C T 5: 24,400,139 R108C possibly damaging Het
Adgrb2 C A 4: 130,017,103 A1104E probably damaging Het
Adgrv1 A G 13: 81,466,259 V4005A probably benign Het
Bend6 T C 1: 33,878,439 probably null Het
Brwd1 A T 16: 96,064,787 V265E probably damaging Het
Ccdc96 A G 5: 36,486,374 I575V probably damaging Het
Cd109 A T 9: 78,700,279 I1094L probably benign Het
Cd44 A G 2: 102,861,670 V91A probably damaging Het
Cdv3 C G 9: 103,364,003 G122R probably damaging Het
Ces2c T A 8: 104,850,901 V272D possibly damaging Het
Colgalt1 T A 8: 71,623,110 M467K probably damaging Het
Crtam G A 9: 40,994,540 T31M possibly damaging Het
Cyp7a1 C T 4: 6,272,371 V281M possibly damaging Het
Dnah7a A T 1: 53,620,670 N726K probably benign Het
Dok6 T C 18: 89,421,018 E232G possibly damaging Het
Gm12185 T C 11: 48,915,713 E217G probably benign Het
Gm7247 C T 14: 51,364,348 S26F probably benign Het
Gria1 A T 11: 57,289,285 Y618F probably damaging Het
H2-T22 A G 17: 36,041,485 Y183H probably benign Het
Hace1 A T 10: 45,670,391 I374L probably benign Het
Hif3a T A 7: 17,053,769 T132S probably benign Het
Hoxa3 T A 6: 52,170,283 probably benign Het
Il27 A C 7: 126,589,363 probably benign Het
Kdelc2 T C 9: 53,395,895 Y380H probably damaging Het
Klhdc1 T C 12: 69,250,774 Y40H probably damaging Het
Klhl33 T G 14: 50,892,651 E462A possibly damaging Het
Myh10 T C 11: 68,814,983 I1979T probably benign Het
Nfkbil1 G T 17: 35,220,798 F246L probably benign Het
Nlrp1b A T 11: 71,181,746 F424I probably damaging Het
Nod1 A G 6: 54,944,554 Y260H probably damaging Het
Ofcc1 A G 13: 40,280,422 L69P probably damaging Het
Olfr1110 T C 2: 87,135,856 N155S probably damaging Het
Olfr1419 A T 19: 11,870,862 I118N possibly damaging Het
Olfr1446 A C 19: 12,890,597 probably null Het
Olfr385 T C 11: 73,589,250 I163V probably benign Het
Olfr968 A G 9: 39,772,692 V36A probably benign Het
Olfr98 C A 17: 37,263,648 Q5H probably benign Het
Onecut2 G T 18: 64,341,548 R390L probably damaging Het
Oprm1 A C 10: 6,832,520 M388L probably benign Het
Pcdhgc5 T A 18: 37,821,060 Y462* probably null Het
Pex1 T A 5: 3,607,704 M425K possibly damaging Het
Plec A T 15: 76,185,905 Y1001N probably damaging Het
Pou2f2 T G 7: 25,097,444 K236Q probably damaging Het
Rbm20 G A 19: 53,851,267 E896K possibly damaging Het
Sh3tc2 T A 18: 61,990,010 L614Q probably damaging Het
Skint5 T A 4: 113,893,832 I339F unknown Het
Slc2a7 T C 4: 150,168,340 I479T probably damaging Het
Snrk A G 9: 122,157,222 N219S probably damaging Het
Ttn A G 2: 76,761,292 I21011T probably damaging Het
Vmn2r11 T A 5: 109,047,055 I802F probably damaging Het
Vmn2r92 T C 17: 18,168,951 probably null Het
Ythdc2 T A 18: 44,886,253 M1363K probably damaging Het
Zan T C 5: 137,378,809 probably benign Het
Zfp521 C A 18: 13,717,624 C1261F probably damaging Het
Zfp980 A T 4: 145,701,909 K403* probably null Het
Other mutations in Supt20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Supt20 APN 3 54715169 missense probably damaging 0.98
IGL01781:Supt20 APN 3 54695205 start codon destroyed probably null 0.47
IGL02510:Supt20 APN 3 54715524 intron probably benign
IGL02656:Supt20 APN 3 54708395 missense probably damaging 1.00
IGL02958:Supt20 APN 3 54713723 intron probably benign
IGL03036:Supt20 APN 3 54709302 nonsense probably null
IGL03128:Supt20 APN 3 54708287 missense probably benign 0.05
IGL03164:Supt20 APN 3 54713188 missense probably benign 0.01
FR4304:Supt20 UTSW 3 54727647 small insertion probably benign
FR4304:Supt20 UTSW 3 54727662 small insertion probably benign
FR4304:Supt20 UTSW 3 54727664 nonsense probably null
FR4449:Supt20 UTSW 3 54727649 small insertion probably benign
FR4548:Supt20 UTSW 3 54727657 small insertion probably benign
FR4548:Supt20 UTSW 3 54727664 small insertion probably benign
FR4548:Supt20 UTSW 3 54727673 small insertion probably benign
FR4589:Supt20 UTSW 3 54727651 small insertion probably benign
FR4589:Supt20 UTSW 3 54727655 small insertion probably benign
FR4589:Supt20 UTSW 3 54727671 small insertion probably benign
FR4737:Supt20 UTSW 3 54727657 small insertion probably benign
FR4737:Supt20 UTSW 3 54727658 small insertion probably benign
FR4737:Supt20 UTSW 3 54727661 small insertion probably benign
R0383:Supt20 UTSW 3 54703149 nonsense probably null
R0675:Supt20 UTSW 3 54706969 missense probably damaging 1.00
R0744:Supt20 UTSW 3 54714701 missense probably damaging 1.00
R0968:Supt20 UTSW 3 54708400 intron probably benign
R1075:Supt20 UTSW 3 54706941 nonsense probably null
R1689:Supt20 UTSW 3 54712162 nonsense probably null
R1772:Supt20 UTSW 3 54710420 missense probably damaging 1.00
R1779:Supt20 UTSW 3 54714743 missense probably benign 0.00
R1829:Supt20 UTSW 3 54727658 utr 3 prime probably benign
R3236:Supt20 UTSW 3 54709080 missense possibly damaging 0.94
R3237:Supt20 UTSW 3 54709080 missense possibly damaging 0.94
R4989:Supt20 UTSW 3 54695134 utr 5 prime probably benign
R5180:Supt20 UTSW 3 54709085 missense probably benign 0.00
R5188:Supt20 UTSW 3 54710428 missense possibly damaging 0.87
R5423:Supt20 UTSW 3 54709325 missense probably damaging 1.00
R5627:Supt20 UTSW 3 54713190 missense possibly damaging 0.86
R5888:Supt20 UTSW 3 54712207 missense probably benign
R6316:Supt20 UTSW 3 54727648 small insertion probably benign
R6623:Supt20 UTSW 3 54718294 missense possibly damaging 0.93
R6713:Supt20 UTSW 3 54698601 missense possibly damaging 0.89
R6874:Supt20 UTSW 3 54727754 intron probably null
R6988:Supt20 UTSW 3 54698597 missense probably damaging 1.00
R7149:Supt20 UTSW 3 54728411 missense unknown
Predicted Primers PCR Primer
(F):5'- TGTGGCTCCATGGTCATGAG -3'
(R):5'- AGCCAGTCATTCGTACAGC -3'

Sequencing Primer
(F):5'- CACCTGTGCTTAAAGCTTGCTGG -3'
(R):5'- TCGTACAGCGAGCACCTTAG -3'
Posted On2017-06-26