Incidental Mutation 'R5995:Il27'
ID481064
Institutional Source Beutler Lab
Gene Symbol Il27
Ensembl Gene ENSMUSG00000044701
Gene Nameinterleukin 27
SynonymsIL-27, IL-27p28, p28, Il30
MMRRC Submission 044174-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.149) question?
Stock #R5995 (G1)
Quality Score114.008
Status Validated
Chromosome7
Chromosomal Location126589010-126594941 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to C at 126589363 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116160 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039522] [ENSMUST00000058429] [ENSMUST00000084589] [ENSMUST00000131860] [ENSMUST00000137646] [ENSMUST00000138558] [ENSMUST00000144173] [ENSMUST00000150311]
Predicted Effect probably benign
Transcript: ENSMUST00000039522
SMART Domains Protein: ENSMUSP00000042028
Gene: ENSMUSG00000042759

DomainStartEndE-ValueType
low complexity region 45 59 N/A INTRINSIC
low complexity region 171 181 N/A INTRINSIC
low complexity region 351 363 N/A INTRINSIC
low complexity region 381 396 N/A INTRINSIC
low complexity region 465 476 N/A INTRINSIC
low complexity region 588 608 N/A INTRINSIC
low complexity region 837 862 N/A INTRINSIC
low complexity region 869 881 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000058429
AA Change: S213A
SMART Domains Protein: ENSMUSP00000054637
Gene: ENSMUSG00000044701
AA Change: S213A

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
low complexity region 137 148 N/A INTRINSIC
low complexity region 160 177 N/A INTRINSIC
low complexity region 210 228 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000084589
SMART Domains Protein: ENSMUSP00000081636
Gene: ENSMUSG00000030720

DomainStartEndE-ValueType
Pfam:CLN3 37 438 3.5e-215 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128049
Predicted Effect probably benign
Transcript: ENSMUST00000131860
Predicted Effect probably benign
Transcript: ENSMUST00000137646
Predicted Effect probably benign
Transcript: ENSMUST00000138558
Predicted Effect probably benign
Transcript: ENSMUST00000144173
Predicted Effect probably benign
Transcript: ENSMUST00000150311
SMART Domains Protein: ENSMUSP00000116160
Gene: ENSMUSG00000030720

DomainStartEndE-ValueType
Pfam:CLN3 37 69 1.5e-14 PFAM
Meta Mutation Damage Score 0.168 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.7%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of the subunits of a heterodimeric cytokine complex. This protein is related to interleukin 12A (IL12A). It interacts with Epstein-Barr virus induced gene 3 (EBI3), a protein similar to interleukin 12B (IL12B), and forms a complex that has been shown to drive rapid expansion of naive but not memory CD4(+) T cells. The complex is also found to synergize strongly with interleukin 12 to trigger interferon gamma (IFNG) production of naive CD4(+) T cells. The biological effects of this cytokine are mediated by the class I cytokine receptor (WSX1/TCRR). [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele develop an exaggerated delayed-type hypersensitivity response and are more susceptible to experimental autoimmune encephalomyelitis due to the presence of an increased number of Th17 cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb8 C T 5: 24,400,139 R108C possibly damaging Het
Adgrb2 C A 4: 130,017,103 A1104E probably damaging Het
Adgrv1 A G 13: 81,466,259 V4005A probably benign Het
Bend6 T C 1: 33,878,439 probably null Het
Brwd1 A T 16: 96,064,787 V265E probably damaging Het
Ccdc96 A G 5: 36,486,374 I575V probably damaging Het
Cd109 A T 9: 78,700,279 I1094L probably benign Het
Cd44 A G 2: 102,861,670 V91A probably damaging Het
Cdv3 C G 9: 103,364,003 G122R probably damaging Het
Ces2c T A 8: 104,850,901 V272D possibly damaging Het
Colgalt1 T A 8: 71,623,110 M467K probably damaging Het
Crtam G A 9: 40,994,540 T31M possibly damaging Het
Cyp7a1 C T 4: 6,272,371 V281M possibly damaging Het
Dnah7a A T 1: 53,620,670 N726K probably benign Het
Dok6 T C 18: 89,421,018 E232G possibly damaging Het
Gm12185 T C 11: 48,915,713 E217G probably benign Het
Gm7247 C T 14: 51,364,348 S26F probably benign Het
Gria1 A T 11: 57,289,285 Y618F probably damaging Het
H2-T22 A G 17: 36,041,485 Y183H probably benign Het
Hace1 A T 10: 45,670,391 I374L probably benign Het
Hif3a T A 7: 17,053,769 T132S probably benign Het
Hoxa3 T A 6: 52,170,283 probably benign Het
Kdelc2 T C 9: 53,395,895 Y380H probably damaging Het
Klhdc1 T C 12: 69,250,774 Y40H probably damaging Het
Klhl33 T G 14: 50,892,651 E462A possibly damaging Het
Myh10 T C 11: 68,814,983 I1979T probably benign Het
Nfkbil1 G T 17: 35,220,798 F246L probably benign Het
Nlrp1b A T 11: 71,181,746 F424I probably damaging Het
Nod1 A G 6: 54,944,554 Y260H probably damaging Het
Ofcc1 A G 13: 40,280,422 L69P probably damaging Het
Olfr1110 T C 2: 87,135,856 N155S probably damaging Het
Olfr1419 A T 19: 11,870,862 I118N possibly damaging Het
Olfr1446 A C 19: 12,890,597 probably null Het
Olfr385 T C 11: 73,589,250 I163V probably benign Het
Olfr968 A G 9: 39,772,692 V36A probably benign Het
Olfr98 C A 17: 37,263,648 Q5H probably benign Het
Onecut2 G T 18: 64,341,548 R390L probably damaging Het
Oprm1 A C 10: 6,832,520 M388L probably benign Het
Pcdhgc5 T A 18: 37,821,060 Y462* probably null Het
Pex1 T A 5: 3,607,704 M425K possibly damaging Het
Plec A T 15: 76,185,905 Y1001N probably damaging Het
Pou2f2 T G 7: 25,097,444 K236Q probably damaging Het
Rbm20 G A 19: 53,851,267 E896K possibly damaging Het
Sh3tc2 T A 18: 61,990,010 L614Q probably damaging Het
Skint5 T A 4: 113,893,832 I339F unknown Het
Slc2a7 T C 4: 150,168,340 I479T probably damaging Het
Snrk A G 9: 122,157,222 N219S probably damaging Het
Supt20 T C 3: 54,709,053 S245P probably damaging Het
Ttn A G 2: 76,761,292 I21011T probably damaging Het
Vmn2r11 T A 5: 109,047,055 I802F probably damaging Het
Vmn2r92 T C 17: 18,168,951 probably null Het
Ythdc2 T A 18: 44,886,253 M1363K probably damaging Het
Zan T C 5: 137,378,809 probably benign Het
Zfp521 C A 18: 13,717,624 C1261F probably damaging Het
Zfp980 A T 4: 145,701,909 K403* probably null Het
Other mutations in Il27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00895:Il27 APN 7 126589383 missense probably benign 0.25
IGL02077:Il27 APN 7 126594879 critical splice donor site probably null
IGL02861:Il27 APN 7 126592649 missense probably damaging 1.00
R1670:Il27 UTSW 7 126589475 missense probably benign 0.02
R4673:Il27 UTSW 7 126591079 missense possibly damaging 0.73
R5494:Il27 UTSW 7 126592928 missense probably damaging 1.00
R5852:Il27 UTSW 7 126592614 missense possibly damaging 0.84
R5955:Il27 UTSW 7 126594898 missense probably benign 0.00
X0064:Il27 UTSW 7 126592626 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AAACGAGCTAGAGCCTGTCC -3'
(R):5'- GCAGAAGGAATGGAGACTCTCTC -3'

Sequencing Primer
(F):5'- GTCCTGTGATTGGCCAGACTC -3'
(R):5'- CTGGCTGCAGGATTCAAATG -3'
Posted On2017-06-26