Incidental Mutation 'R5995:Gria1'
ID481077
Institutional Source Beutler Lab
Gene Symbol Gria1
Ensembl Gene ENSMUSG00000020524
Gene Nameglutamate receptor, ionotropic, AMPA1 (alpha 1)
SynonymsGlr1, Glur-1, GluRA, HIPA1, GluR1, GluR-A, 2900051M01Rik, Glur1, GluA1, Glr-1
MMRRC Submission 044174-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.232) question?
Stock #R5995 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location57011387-57330244 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 57289285 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 618 (Y618F)
Ref Sequence ENSEMBL: ENSMUSP00000117746 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036315] [ENSMUST00000094179] [ENSMUST00000151045]
Predicted Effect probably damaging
Transcript: ENSMUST00000036315
AA Change: Y687F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000044494
Gene: ENSMUSG00000020524
AA Change: Y687F

DomainStartEndE-ValueType
Pfam:ANF_receptor 37 372 9.3e-63 PFAM
PBPe 408 783 3.65e-121 SMART
Lig_chan-Glu_bd 418 483 1.65e-29 SMART
low complexity region 863 874 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000094179
AA Change: Y687F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000091731
Gene: ENSMUSG00000020524
AA Change: Y687F

DomainStartEndE-ValueType
Pfam:ANF_receptor 37 372 3.7e-69 PFAM
PBPe 408 783 2.09e-121 SMART
Lig_chan-Glu_bd 418 483 1.65e-29 SMART
low complexity region 863 874 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000151045
AA Change: Y618F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000117746
Gene: ENSMUSG00000020524
AA Change: Y618F

DomainStartEndE-ValueType
Pfam:ANF_receptor 1 303 4.7e-58 PFAM
PBPe 339 714 3.65e-121 SMART
Lig_chan-Glu_bd 349 414 1.65e-29 SMART
transmembrane domain 739 761 N/A INTRINSIC
low complexity region 794 805 N/A INTRINSIC
Meta Mutation Damage Score 0.084 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.7%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. These receptors are heteromeric protein complexes with multiple subunits, each possessing transmembrane regions, and all arranged to form a ligand-gated ion channel. The classification of glutamate receptors is based on their activation by different pharmacologic agonists. This gene belongs to a family of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate (AMPA) receptors. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice with mutations in phosphorylation sites have LTD and LTP deficits and spatial learning memory defects. Null homozygotes also show stimulus-reward learning deficits and increases locomotor activity and context-dependent sensitization to amphetamine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb8 C T 5: 24,400,139 R108C possibly damaging Het
Adgrb2 C A 4: 130,017,103 A1104E probably damaging Het
Adgrv1 A G 13: 81,466,259 V4005A probably benign Het
Bend6 T C 1: 33,878,439 probably null Het
Brwd1 A T 16: 96,064,787 V265E probably damaging Het
Ccdc96 A G 5: 36,486,374 I575V probably damaging Het
Cd109 A T 9: 78,700,279 I1094L probably benign Het
Cd44 A G 2: 102,861,670 V91A probably damaging Het
Cdv3 C G 9: 103,364,003 G122R probably damaging Het
Ces2c T A 8: 104,850,901 V272D possibly damaging Het
Colgalt1 T A 8: 71,623,110 M467K probably damaging Het
Crtam G A 9: 40,994,540 T31M possibly damaging Het
Cyp7a1 C T 4: 6,272,371 V281M possibly damaging Het
Dnah7a A T 1: 53,620,670 N726K probably benign Het
Dok6 T C 18: 89,421,018 E232G possibly damaging Het
Gm12185 T C 11: 48,915,713 E217G probably benign Het
Gm7247 C T 14: 51,364,348 S26F probably benign Het
H2-T22 A G 17: 36,041,485 Y183H probably benign Het
Hace1 A T 10: 45,670,391 I374L probably benign Het
Hif3a T A 7: 17,053,769 T132S probably benign Het
Hoxa3 T A 6: 52,170,283 probably benign Het
Il27 A C 7: 126,589,363 probably benign Het
Kdelc2 T C 9: 53,395,895 Y380H probably damaging Het
Klhdc1 T C 12: 69,250,774 Y40H probably damaging Het
Klhl33 T G 14: 50,892,651 E462A possibly damaging Het
Myh10 T C 11: 68,814,983 I1979T probably benign Het
Nfkbil1 G T 17: 35,220,798 F246L probably benign Het
Nlrp1b A T 11: 71,181,746 F424I probably damaging Het
Nod1 A G 6: 54,944,554 Y260H probably damaging Het
Ofcc1 A G 13: 40,280,422 L69P probably damaging Het
Olfr1110 T C 2: 87,135,856 N155S probably damaging Het
Olfr1419 A T 19: 11,870,862 I118N possibly damaging Het
Olfr1446 A C 19: 12,890,597 probably null Het
Olfr385 T C 11: 73,589,250 I163V probably benign Het
Olfr968 A G 9: 39,772,692 V36A probably benign Het
Olfr98 C A 17: 37,263,648 Q5H probably benign Het
Onecut2 G T 18: 64,341,548 R390L probably damaging Het
Oprm1 A C 10: 6,832,520 M388L probably benign Het
Pcdhgc5 T A 18: 37,821,060 Y462* probably null Het
Pex1 T A 5: 3,607,704 M425K possibly damaging Het
Plec A T 15: 76,185,905 Y1001N probably damaging Het
Pou2f2 T G 7: 25,097,444 K236Q probably damaging Het
Rbm20 G A 19: 53,851,267 E896K possibly damaging Het
Sh3tc2 T A 18: 61,990,010 L614Q probably damaging Het
Skint5 T A 4: 113,893,832 I339F unknown Het
Slc2a7 T C 4: 150,168,340 I479T probably damaging Het
Snrk A G 9: 122,157,222 N219S probably damaging Het
Supt20 T C 3: 54,709,053 S245P probably damaging Het
Ttn A G 2: 76,761,292 I21011T probably damaging Het
Vmn2r11 T A 5: 109,047,055 I802F probably damaging Het
Vmn2r92 T C 17: 18,168,951 probably null Het
Ythdc2 T A 18: 44,886,253 M1363K probably damaging Het
Zan T C 5: 137,378,809 probably benign Het
Zfp521 C A 18: 13,717,624 C1261F probably damaging Het
Zfp980 A T 4: 145,701,909 K403* probably null Het
Other mutations in Gria1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00475:Gria1 APN 11 57242941 nonsense probably null
IGL00807:Gria1 APN 11 57012040 missense probably benign
IGL00816:Gria1 APN 11 57317742 missense possibly damaging 0.93
IGL01110:Gria1 APN 11 57289381 missense probably damaging 1.00
IGL01116:Gria1 APN 11 57236975 missense probably damaging 1.00
IGL01120:Gria1 APN 11 57317669 missense probably damaging 0.99
IGL01843:Gria1 APN 11 57317774 missense probably damaging 1.00
IGL02135:Gria1 APN 11 57185853 missense probably damaging 1.00
IGL02308:Gria1 APN 11 57236924 missense probably benign 0.00
IGL02554:Gria1 APN 11 57289488 missense possibly damaging 0.72
IGL02813:Gria1 APN 11 57283584 missense probably damaging 1.00
IGL03071:Gria1 APN 11 57012110 unclassified probably null
IGL03326:Gria1 APN 11 57317773 missense probably damaging 1.00
PIT4445001:Gria1 UTSW 11 57185838 missense probably damaging 1.00
R0087:Gria1 UTSW 11 57317712 missense probably damaging 1.00
R0387:Gria1 UTSW 11 57309884 critical splice donor site probably null
R0399:Gria1 UTSW 11 57186027 missense probably damaging 0.97
R0502:Gria1 UTSW 11 57189716 missense probably damaging 1.00
R0503:Gria1 UTSW 11 57189716 missense probably damaging 1.00
R0549:Gria1 UTSW 11 57228973 missense probably damaging 1.00
R0590:Gria1 UTSW 11 57289409 missense probably damaging 1.00
R1377:Gria1 UTSW 11 57201176 missense probably damaging 1.00
R1395:Gria1 UTSW 11 57283566 missense probably damaging 1.00
R1422:Gria1 UTSW 11 57189788 missense probably benign 0.00
R1581:Gria1 UTSW 11 57237010 splice site probably null
R2002:Gria1 UTSW 11 57012104 missense possibly damaging 0.93
R2064:Gria1 UTSW 11 57317708 missense probably damaging 0.98
R2255:Gria1 UTSW 11 57185949 missense probably damaging 1.00
R2507:Gria1 UTSW 11 57289320 missense probably null 0.30
R2965:Gria1 UTSW 11 57185801 nonsense probably null
R3012:Gria1 UTSW 11 57289434 missense probably damaging 1.00
R3151:Gria1 UTSW 11 57283562 missense probably damaging 1.00
R3807:Gria1 UTSW 11 57310678 missense probably damaging 1.00
R5026:Gria1 UTSW 11 57310696 missense probably damaging 1.00
R5132:Gria1 UTSW 11 57289399 missense probably damaging 1.00
R5222:Gria1 UTSW 11 57189797 missense probably benign 0.22
R5303:Gria1 UTSW 11 57243025 missense probably benign 0.01
R5332:Gria1 UTSW 11 57327621 missense possibly damaging 0.93
R5413:Gria1 UTSW 11 57217794 missense probably benign 0.00
R5748:Gria1 UTSW 11 57309876 missense probably benign 0.00
R5878:Gria1 UTSW 11 57317802 critical splice donor site probably null
R5937:Gria1 UTSW 11 57189733 missense probably benign 0.00
R6031:Gria1 UTSW 11 57217782 missense probably damaging 1.00
R6031:Gria1 UTSW 11 57217782 missense probably damaging 1.00
R6180:Gria1 UTSW 11 57242792 missense probably damaging 1.00
R6187:Gria1 UTSW 11 57238110 missense possibly damaging 0.84
R6262:Gria1 UTSW 11 57242854 missense probably damaging 1.00
R6828:Gria1 UTSW 11 57289462 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGTACCTTGGAACCTACTGG -3'
(R):5'- TTGGAATCCAAGTTACCTCCC -3'

Sequencing Primer
(F):5'- CCTACTGGTACTAATTAGAGGCTC -3'
(R):5'- CCACTTTCATGGTGTCACAGGG -3'
Posted On2017-06-26