Incidental Mutation 'R5978:Rnf115'
ID481243
Institutional Source Beutler Lab
Gene Symbol Rnf115
Ensembl Gene ENSMUSG00000028098
Gene Namering finger protein 115
Synonyms2610028E05Rik, Rabring7, Zfp364
MMRRC Submission 044160-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.429) question?
Stock #R5978 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location96727664-96791638 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 96788666 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 256 (I256N)
Ref Sequence ENSEMBL: ENSMUSP00000029740 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029740] [ENSMUST00000199051]
Predicted Effect probably damaging
Transcript: ENSMUST00000029740
AA Change: I256N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029740
Gene: ENSMUSG00000028098
AA Change: I256N

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
RING 229 269 1.14e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197286
Predicted Effect probably benign
Transcript: ENSMUST00000199051
SMART Domains Protein: ENSMUSP00000143321
Gene: ENSMUSG00000028098

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
Pfam:zf-RING_3 18 49 4.5e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199974
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anks6 T A 4: 47,049,252 S218C probably damaging Het
Atp2c2 G A 8: 119,749,875 probably null Het
Ccdc146 T G 5: 21,316,968 I353L probably benign Het
Cst3 A T 2: 148,872,821 M112K probably benign Het
Cst3 T G 2: 148,872,822 M112L probably benign Het
Cyp2j11 A C 4: 96,319,352 L242R probably damaging Het
Eif5b T C 1: 37,998,280 probably null Het
Espl1 A G 15: 102,315,774 I1253M possibly damaging Het
Fstl5 C T 3: 76,145,085 H41Y probably damaging Het
Gm11011 T C 2: 169,584,441 K84R unknown Het
Hax1 GTCATCATCATCATCATC GTCATCATCATCATCATCATC 3: 89,997,940 probably benign Het
Heatr5b C A 17: 78,806,036 V923F probably damaging Het
Hnrnpll G A 17: 80,034,191 T473M probably damaging Het
Iars T A 13: 49,722,993 Y845N probably damaging Het
Il34 T A 8: 110,742,685 D166V probably damaging Het
Kel T A 6: 41,688,045 H595L probably benign Het
Krt77 T C 15: 101,862,928 I313M probably benign Het
Krt84 T C 15: 101,530,230 E274G probably damaging Het
Mctp2 T C 7: 72,090,188 Y818C probably damaging Het
Mrc1 A T 2: 14,315,393 Y1046F probably damaging Het
Myom1 A T 17: 71,117,443 D1429V probably damaging Het
Ncapg2 T C 12: 116,424,671 M325T possibly damaging Het
Nf1 T A 11: 79,540,419 I1902N probably damaging Het
Nkain3 A T 4: 20,485,026 probably null Het
Nlrc5 A T 8: 94,488,593 N940Y probably damaging Het
Nlrp9a T A 7: 26,557,278 I107K probably damaging Het
Ntn5 T C 7: 45,694,013 S328P possibly damaging Het
Olfr346 A C 2: 36,688,682 K227Q probably benign Het
Parp8 A C 13: 116,895,732 S302A probably benign Het
Ptgr2 G T 12: 84,295,258 E27* probably null Het
Ryr3 T A 2: 112,672,269 H3515L probably benign Het
Scel A G 14: 103,529,254 probably null Het
Slc4a5 T A 6: 83,277,536 S572T probably benign Het
Slc4a9 T G 18: 36,535,403 I705S probably damaging Het
Spint4 C T 2: 164,700,332 P101L probably damaging Het
Syt9 T A 7: 107,436,413 D212E probably benign Het
Tmem39a T A 16: 38,591,030 M449K probably benign Het
Ttn T C 2: 76,808,799 T13877A possibly damaging Het
Ube2v2 T C 16: 15,577,127 N20S probably benign Het
Vmn1r14 C T 6: 57,233,944 S169F probably benign Het
Vps13d T C 4: 145,122,611 H2410R probably benign Het
Wdr81 G A 11: 75,444,398 L1781F probably damaging Het
Zfp91 A G 19: 12,770,151 I536T probably benign Het
Other mutations in Rnf115
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03388:Rnf115 APN 3 96788668 missense probably damaging 0.98
R0051:Rnf115 UTSW 3 96785022 missense probably damaging 1.00
R0051:Rnf115 UTSW 3 96785022 missense probably damaging 1.00
R1864:Rnf115 UTSW 3 96727837 unclassified probably benign
R3015:Rnf115 UTSW 3 96754359 missense probably damaging 1.00
R4030:Rnf115 UTSW 3 96785983 missense probably damaging 1.00
R4590:Rnf115 UTSW 3 96788573 missense probably benign 0.00
R5370:Rnf115 UTSW 3 96758020 missense probably benign 0.05
R5820:Rnf115 UTSW 3 96727848 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- ACACCTACGTTTCTTGGGTTG -3'
(R):5'- AATGCCAGCAGTACTAGGGTC -3'

Sequencing Primer
(F):5'- AGGTTAGCCTTGACCATCCGTG -3'
(R):5'- CAGCAGTACTAGGGTCCGCAAG -3'
Posted On2017-06-26