Incidental Mutation 'R5979:Lama2'
ID481321
Institutional Source Beutler Lab
Gene Symbol Lama2
Ensembl Gene ENSMUSG00000019899
Gene Namelaminin, alpha 2
Synonymsmerosin, mer
MMRRC Submission 044161-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.558) question?
Stock #R5979 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location26980036-27619758 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 27235732 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 764 (D764G)
Ref Sequence ENSEMBL: ENSMUSP00000140716 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092639] [ENSMUST00000189575]
Predicted Effect possibly damaging
Transcript: ENSMUST00000092639
AA Change: D764G

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000090304
Gene: ENSMUSG00000019899
AA Change: D764G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LamNT 29 281 5.35e-129 SMART
EGF_Lam 283 337 2.11e-4 SMART
EGF_Lam 340 407 1.59e-8 SMART
EGF_Lam 410 462 5.44e-7 SMART
EGF_Lam 465 511 9.05e-4 SMART
LamB 574 706 2.26e-44 SMART
Pfam:Laminin_EGF 715 745 2.8e-4 PFAM
EGF_Lam 753 800 4.03e-10 SMART
EGF_Lam 803 858 3.01e-9 SMART
EGF_Lam 861 911 1.35e-11 SMART
EGF_Lam 914 960 7.23e-12 SMART
EGF_Lam 963 1007 5.87e-12 SMART
EGF_Lam 1010 1053 1.28e-12 SMART
EGF_Lam 1056 1099 2.37e-7 SMART
EGF_Lam 1102 1159 3.22e-9 SMART
LamB 1225 1360 1.95e-57 SMART
EGF_like 1364 1413 8.13e-1 SMART
EGF_Lam 1416 1462 5.48e-12 SMART
EGF_Lam 1465 1520 1.27e-7 SMART
EGF_Lam 1523 1567 2.4e-8 SMART
Pfam:Laminin_I 1584 1849 2e-92 PFAM
Blast:MA 1881 2113 1e-112 BLAST
LamG 2162 2307 1.28e-25 SMART
LamG 2356 2500 2.2e-33 SMART
LamG 2542 2688 3.31e-28 SMART
low complexity region 2725 2741 N/A INTRINSIC
LamG 2781 2914 2.25e-39 SMART
LamG 2956 3092 1.53e-32 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000189575
AA Change: D764G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000140716
Gene: ENSMUSG00000019899
AA Change: D764G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LamNT 29 281 2.5e-131 SMART
EGF_Lam 283 337 1e-6 SMART
EGF_Lam 340 407 7.7e-11 SMART
EGF_Lam 410 462 2.6e-9 SMART
EGF_Lam 465 511 4.5e-6 SMART
LamB 574 706 1.4e-46 SMART
Pfam:Laminin_EGF 715 745 1.7e-2 PFAM
EGF_Lam 753 800 1.9e-12 SMART
EGF_Lam 803 858 1.4e-11 SMART
EGF_Lam 861 911 6.7e-14 SMART
EGF_Lam 914 960 3.6e-14 SMART
EGF_Lam 963 1007 2.9e-14 SMART
EGF_Lam 1010 1053 6.1e-15 SMART
EGF_Lam 1056 1099 1.1e-9 SMART
EGF_Lam 1102 1159 1.5e-11 SMART
LamB 1225 1349 1.4e-45 SMART
Meta Mutation Damage Score 0.15 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency 100% (87/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminin, an extracellular protein, is a major component of the basement membrane. It is thought to mediate the attachment, migration, and organization of cells into tissues during embryonic development by interacting with other extracellular matrix components. It is composed of three subunits, alpha, beta, and gamma, which are bound to each other by disulfide bonds into a cross-shaped molecule. This gene encodes the alpha 2 chain, which constitutes one of the subunits of laminin 2 (merosin) and laminin 4 (s-merosin). Mutations in this gene have been identified as the cause of congenital merosin-deficient muscular dystrophy. Two transcript variants encoding different proteins have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted and spontaneous mutations exhibit progressive growth retardation, ataxia, muscle atrophy and degeneration, infertility, and premature lethality. Muscle fiber degeneration is evident as early as the first week of life. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss2 A G 2: 155,522,109 I103V possibly damaging Het
Adam3 T C 8: 24,677,367 N36S probably benign Het
Adamts3 A G 5: 89,861,669 V45A probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Agtpbp1 A T 13: 59,534,046 L69* probably null Het
Alkbh5 T A 11: 60,538,691 I90N probably damaging Het
Alx1 T C 10: 103,022,259 Y193C probably damaging Het
Ankrd11 T G 8: 122,892,400 D1571A probably damaging Het
Brd4 T C 17: 32,198,726 D124G probably benign Het
C2cd2 G A 16: 97,875,218 T443I probably benign Het
Casp8 A T 1: 58,828,912 M171L probably benign Het
Cd200r4 G A 16: 44,832,932 V22I probably benign Het
Cdcp2 A G 4: 107,105,281 Y217C probably damaging Het
Cfh C A 1: 140,118,671 V556F possibly damaging Het
Chka T G 19: 3,884,513 I182M probably damaging Het
Cope T C 8: 70,302,543 probably null Het
Coq10b T C 1: 55,052,918 V15A probably benign Het
Cpne9 T A 6: 113,293,749 S309T probably benign Het
Daam2 T A 17: 49,459,204 H992L possibly damaging Het
Dctn3 T C 4: 41,715,393 probably null Het
Dhx35 G T 2: 158,842,869 R536L probably benign Het
Dnah8 G T 17: 30,815,664 E4186* probably null Het
Dnah9 A G 11: 65,834,481 L4282P probably damaging Het
Dpp10 A G 1: 123,384,283 probably null Het
Dst T A 1: 34,160,372 probably benign Het
Ehbp1 C A 11: 22,151,887 V214L probably benign Het
Fam131b T C 6: 42,321,971 D25G probably damaging Het
Fbxl13 T A 5: 21,582,091 I283F probably damaging Het
Gabrr3 T G 16: 59,434,568 N205K possibly damaging Het
Got1l1 C T 8: 27,197,923 probably null Het
Gprin1 G A 13: 54,739,978 A161V probably benign Het
Hepacam2 A T 6: 3,476,149 F183I probably damaging Het
Hmx2 A G 7: 131,554,550 T82A probably benign Het
Igsf10 C T 3: 59,336,473 E147K probably damaging Het
Kndc1 G A 7: 139,939,827 A1700T probably benign Het
Knl1 T C 2: 119,069,360 V514A possibly damaging Het
Lgi3 G A 14: 70,536,460 R358H probably damaging Het
Limd1 G T 9: 123,479,414 Q59H possibly damaging Het
Lrrk2 A G 15: 91,772,945 Y1814C possibly damaging Het
Lysmd3 G A 13: 81,665,274 probably null Het
Mroh7 T C 4: 106,720,926 N185S probably benign Het
Muc2 A G 7: 141,697,250 probably null Het
Muc2 G A 7: 141,751,406 G149D probably damaging Het
Nlrp3 T C 11: 59,548,971 F458S probably benign Het
Nop58 A T 1: 59,702,831 D173V probably damaging Het
Nrxn1 C T 17: 91,088,203 R175H possibly damaging Het
Nxpe4 A G 9: 48,396,562 N322S probably benign Het
Ocstamp A G 2: 165,397,547 S240P probably damaging Het
Olfr137 T C 17: 38,305,192 K90E probably benign Het
Olfr311 A G 11: 58,841,840 H242R probably damaging Het
Olfr713 G A 7: 107,036,336 M60I probably damaging Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Ovch2 G A 7: 107,794,388 T177I possibly damaging Het
Parn A C 16: 13,606,171 L454R probably damaging Het
Pcdhb12 T A 18: 37,437,991 L730Q possibly damaging Het
Phf3 G T 1: 30,805,746 F1377L probably damaging Het
Pign G T 1: 105,589,274 S542R probably benign Het
Prex2 G T 1: 11,132,372 V502F probably damaging Het
Psmd1 A T 1: 86,090,053 I529F possibly damaging Het
Ptafr A G 4: 132,579,305 E2G probably benign Het
R3hdm1 A G 1: 128,211,223 N380S probably benign Het
Rbm12 A C 2: 156,097,759 probably benign Het
Rgl1 A G 1: 152,557,493 Y174H probably damaging Het
Rps6kc1 A G 1: 190,800,435 S457P probably damaging Het
Sall4 A T 2: 168,750,343 S964T probably benign Het
Sart1 T A 19: 5,381,223 I681F probably damaging Het
Serinc5 T C 13: 92,661,136 L49P probably benign Het
Serpinb9e T C 13: 33,255,053 V154A probably benign Het
Skiv2l A T 17: 34,841,463 N851K probably benign Het
Smox G A 2: 131,516,414 V136I probably damaging Het
Sspo C T 6: 48,463,693 T1747I probably benign Het
Swt1 A T 1: 151,407,588 D339E possibly damaging Het
Synpo2 A G 3: 123,117,411 L195P probably damaging Het
Syt7 G T 19: 10,443,479 G414W probably damaging Het
Tmem186 G A 16: 8,636,160 T79I probably damaging Het
Tmem39a A T 16: 38,575,744 N113I probably damaging Het
Trim14 C T 4: 46,507,239 V326M probably damaging Het
Trim58 A G 11: 58,646,083 E234G probably damaging Het
Ttr T C 18: 20,670,002 L75P probably damaging Het
Ubr1 C T 2: 120,946,382 V293I probably benign Het
Vmn1r91 T A 7: 20,102,065 V303E probably benign Het
Vmn2r30 A C 7: 7,312,335 I833S probably damaging Het
Zfp131 G T 13: 119,776,446 N125K probably benign Het
Zfp169 A T 13: 48,491,040 probably benign Het
Zfp213 C A 17: 23,557,911 E386* probably null Het
Other mutations in Lama2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Lama2 APN 10 27188265 missense probably benign 0.01
IGL00467:Lama2 APN 10 27467197 splice site probably benign
IGL00470:Lama2 APN 10 27243742 missense probably benign 0.22
IGL00517:Lama2 APN 10 27197330 missense probably benign 0.01
IGL00541:Lama2 APN 10 27188306 missense probably benign 0.14
IGL00931:Lama2 APN 10 27006776 missense possibly damaging 0.92
IGL00951:Lama2 APN 10 27030285 missense probably benign 0.03
IGL00988:Lama2 APN 10 27369015 nonsense probably null
IGL01098:Lama2 APN 10 27031112 missense possibly damaging 0.66
IGL01152:Lama2 APN 10 27208429 missense probably benign 0.00
IGL01293:Lama2 APN 10 27231636 missense probably benign 0.38
IGL01338:Lama2 APN 10 27188272 missense probably benign 0.13
IGL01609:Lama2 APN 10 27344421 missense probably benign 0.03
IGL01643:Lama2 APN 10 27070372 splice site probably benign
IGL01675:Lama2 APN 10 27188054 missense possibly damaging 0.77
IGL01681:Lama2 APN 10 27265045 missense probably benign 0.33
IGL01694:Lama2 APN 10 27006742 missense possibly damaging 0.75
IGL01705:Lama2 APN 10 27189274 splice site probably benign
IGL01885:Lama2 APN 10 27105139 nonsense probably null
IGL01935:Lama2 APN 10 27422604 missense probably damaging 0.98
IGL01994:Lama2 APN 10 27467203 critical splice donor site probably null
IGL02041:Lama2 APN 10 26984326 missense probably damaging 1.00
IGL02067:Lama2 APN 10 27176796 missense probably benign 0.02
IGL02097:Lama2 APN 10 27138960 missense probably benign 0.09
IGL02179:Lama2 APN 10 27070364 missense probably benign 0.01
IGL02268:Lama2 APN 10 27001116 splice site probably benign
IGL02302:Lama2 APN 10 27212043 missense probably benign 0.06
IGL02363:Lama2 APN 10 27366066 missense probably damaging 1.00
IGL02378:Lama2 APN 10 27043656 missense probably damaging 0.99
IGL02642:Lama2 APN 10 27467273 missense probably damaging 1.00
IGL02676:Lama2 APN 10 27118493 missense probably benign 0.00
IGL02695:Lama2 APN 10 27000775 missense probably benign
IGL02735:Lama2 APN 10 27104128 missense probably damaging 1.00
IGL02794:Lama2 APN 10 27041231 missense possibly damaging 0.73
IGL02823:Lama2 APN 10 27001145 missense probably damaging 1.00
IGL02869:Lama2 APN 10 27015538 missense probably damaging 0.99
IGL02942:Lama2 APN 10 27041220 missense probably damaging 1.00
IGL03201:Lama2 APN 10 27344570 nonsense probably null
IGL03268:Lama2 APN 10 27422653 missense probably damaging 1.00
IGL03288:Lama2 APN 10 27369051 missense probably damaging 1.00
IGL03380:Lama2 APN 10 27050265 missense probably damaging 1.00
IGL03407:Lama2 APN 10 27347021 missense probably damaging 1.00
cowboy UTSW 10 27043643 frame shift probably null
petri UTSW 10 26993398 splice site probably null
R0038:Lama2 UTSW 10 26986797 missense probably benign 0.02
R0038:Lama2 UTSW 10 26986797 missense probably benign 0.02
R0114:Lama2 UTSW 10 26993068 nonsense probably null
R0142:Lama2 UTSW 10 27187845 missense probably benign
R0313:Lama2 UTSW 10 26993398 splice site probably null
R0376:Lama2 UTSW 10 27015546 missense possibly damaging 0.68
R0412:Lama2 UTSW 10 27190625 missense possibly damaging 0.58
R0472:Lama2 UTSW 10 26990867 missense probably damaging 1.00
R0607:Lama2 UTSW 10 27189131 missense probably benign 0.34
R0648:Lama2 UTSW 10 26989376 missense probably benign 0.00
R0667:Lama2 UTSW 10 27344410 splice site probably null
R0760:Lama2 UTSW 10 27044433 critical splice donor site probably null
R1240:Lama2 UTSW 10 27041124 missense probably damaging 1.00
R1385:Lama2 UTSW 10 27224043 missense probably benign 0.11
R1433:Lama2 UTSW 10 27187754 missense probably damaging 1.00
R1434:Lama2 UTSW 10 27208370 missense probably damaging 1.00
R1574:Lama2 UTSW 10 27324754 missense possibly damaging 0.65
R1574:Lama2 UTSW 10 27324754 missense possibly damaging 0.65
R1645:Lama2 UTSW 10 27368985 missense probably damaging 1.00
R1702:Lama2 UTSW 10 27190529 missense probably benign
R1703:Lama2 UTSW 10 27266671 missense probably damaging 1.00
R1769:Lama2 UTSW 10 27208406 missense probably damaging 1.00
R1769:Lama2 UTSW 10 27208407 missense probably benign
R1846:Lama2 UTSW 10 27212096 missense probably damaging 1.00
R1859:Lama2 UTSW 10 27031082 missense possibly damaging 0.51
R1871:Lama2 UTSW 10 26984494 missense probably damaging 1.00
R1903:Lama2 UTSW 10 27188399 missense probably damaging 1.00
R1906:Lama2 UTSW 10 27056527 critical splice donor site probably null
R1958:Lama2 UTSW 10 26981598 missense probably damaging 0.97
R1959:Lama2 UTSW 10 27422618 missense probably damaging 1.00
R1977:Lama2 UTSW 10 26990800 splice site probably null
R2063:Lama2 UTSW 10 27164926 missense probably damaging 1.00
R2079:Lama2 UTSW 10 27369053 missense probably damaging 0.99
R2085:Lama2 UTSW 10 27204841 nonsense probably null
R2125:Lama2 UTSW 10 27044453 nonsense probably null
R2140:Lama2 UTSW 10 27054694 splice site probably null
R2219:Lama2 UTSW 10 27043569 missense probably damaging 0.99
R2259:Lama2 UTSW 10 27031127 missense probably benign 0.00
R2265:Lama2 UTSW 10 26992936 missense probably damaging 1.00
R2266:Lama2 UTSW 10 26986797 missense probably benign 0.02
R2267:Lama2 UTSW 10 26992936 missense probably damaging 1.00
R2268:Lama2 UTSW 10 26992936 missense probably damaging 1.00
R2269:Lama2 UTSW 10 26992936 missense probably damaging 1.00
R2862:Lama2 UTSW 10 27422612 nonsense probably null
R2912:Lama2 UTSW 10 27000803 missense probably benign
R2999:Lama2 UTSW 10 26989421 missense probably benign 0.18
R3034:Lama2 UTSW 10 27001235 missense probably benign 0.11
R3081:Lama2 UTSW 10 27001235 missense probably benign 0.11
R3107:Lama2 UTSW 10 27001235 missense probably benign 0.11
R3109:Lama2 UTSW 10 27001235 missense probably benign 0.11
R3436:Lama2 UTSW 10 27001235 missense probably benign 0.11
R3437:Lama2 UTSW 10 27001235 missense probably benign 0.11
R3706:Lama2 UTSW 10 27138996 missense probably damaging 1.00
R3780:Lama2 UTSW 10 27459339 missense probably damaging 1.00
R3807:Lama2 UTSW 10 27190665 frame shift probably null
R3919:Lama2 UTSW 10 27118505 missense probably damaging 1.00
R4014:Lama2 UTSW 10 26984376 missense probably damaging 1.00
R4131:Lama2 UTSW 10 27041174 missense probably benign 0.00
R4190:Lama2 UTSW 10 27266664 missense probably damaging 0.96
R4273:Lama2 UTSW 10 27347054 missense probably damaging 1.00
R4358:Lama2 UTSW 10 26984493 missense probably damaging 1.00
R4407:Lama2 UTSW 10 27212128 small deletion probably benign
R4415:Lama2 UTSW 10 26989344 nonsense probably null
R4426:Lama2 UTSW 10 27422558 missense probably damaging 1.00
R4590:Lama2 UTSW 10 26989414 missense probably benign 0.00
R4615:Lama2 UTSW 10 26981524 missense probably damaging 0.99
R4736:Lama2 UTSW 10 27204929 missense probably damaging 1.00
R4754:Lama2 UTSW 10 27118531 missense possibly damaging 0.58
R4791:Lama2 UTSW 10 27467271 missense probably damaging 1.00
R4834:Lama2 UTSW 10 27006749 missense probably benign 0.30
R4856:Lama2 UTSW 10 27043643 frame shift probably null
R4858:Lama2 UTSW 10 27043643 frame shift probably null
R4859:Lama2 UTSW 10 27043643 frame shift probably null
R4897:Lama2 UTSW 10 27043643 frame shift probably null
R4898:Lama2 UTSW 10 27043643 frame shift probably null
R4899:Lama2 UTSW 10 27043643 frame shift probably null
R4907:Lama2 UTSW 10 27164946 missense probably benign 0.11
R4911:Lama2 UTSW 10 27138927 missense probably damaging 1.00
R4924:Lama2 UTSW 10 27369141 missense probably damaging 0.98
R5023:Lama2 UTSW 10 27190504 missense probably damaging 0.97
R5057:Lama2 UTSW 10 27164986 missense probably damaging 1.00
R5070:Lama2 UTSW 10 27350251 critical splice donor site probably null
R5116:Lama2 UTSW 10 27118560 missense probably benign 0.08
R5177:Lama2 UTSW 10 27190703 missense possibly damaging 0.94
R5198:Lama2 UTSW 10 27347003 missense probably damaging 0.96
R5289:Lama2 UTSW 10 27212073 nonsense probably null
R5327:Lama2 UTSW 10 27138946 missense probably benign
R5424:Lama2 UTSW 10 26984396 missense probably damaging 1.00
R5469:Lama2 UTSW 10 27041189 missense possibly damaging 0.92
R5620:Lama2 UTSW 10 26990880 missense probably damaging 0.99
R5667:Lama2 UTSW 10 27190544 missense probably damaging 1.00
R5671:Lama2 UTSW 10 27190544 missense probably damaging 1.00
R5815:Lama2 UTSW 10 26986851 missense probably damaging 1.00
R5917:Lama2 UTSW 10 27190697 missense probably damaging 1.00
R5935:Lama2 UTSW 10 27015498 missense probably benign
R5976:Lama2 UTSW 10 27190676 missense probably benign 0.00
R6004:Lama2 UTSW 10 27235785 missense probably benign 0.01
R6180:Lama2 UTSW 10 26981499 missense probably benign 0.03
R6198:Lama2 UTSW 10 27188022 missense probably damaging 1.00
R6257:Lama2 UTSW 10 26986899 missense possibly damaging 0.85
R6271:Lama2 UTSW 10 27023329 missense possibly damaging 0.67
R6322:Lama2 UTSW 10 27190547 missense probably damaging 0.96
R6354:Lama2 UTSW 10 27212068 missense probably damaging 1.00
R6431:Lama2 UTSW 10 27053031 missense possibly damaging 0.50
R6499:Lama2 UTSW 10 27031158 missense probably damaging 1.00
R6535:Lama2 UTSW 10 27104131 missense probably damaging 1.00
R6545:Lama2 UTSW 10 27176797 missense probably benign
R6636:Lama2 UTSW 10 27124568 missense probably benign 0.13
R6891:Lama2 UTSW 10 27328072 nonsense probably null
R6891:Lama2 UTSW 10 27328082 nonsense probably null
R6902:Lama2 UTSW 10 26981629 missense probably damaging 1.00
R6908:Lama2 UTSW 10 27031196 splice site probably null
Predicted Primers PCR Primer
(F):5'- CGGGAGATGACATATGAAATAGCATTC -3'
(R):5'- TGCTGAGTTCACTACCTGAGTTC -3'

Sequencing Primer
(F):5'- AGCATTCTTAGCATCTAACTCACTTC -3'
(R):5'- CTAGGCACCGAAGAGTTA -3'
Posted On2017-06-26