Incidental Mutation 'R5982:Ppat'
ID481444
Institutional Source Beutler Lab
Gene Symbol Ppat
Ensembl Gene ENSMUSG00000029246
Gene Namephosphoribosyl pyrophosphate amidotransferase
Synonyms
MMRRC Submission 044163-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock #R5982 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location76913249-76951578 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 76915265 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 500 (T500A)
Ref Sequence ENSEMBL: ENSMUSP00000120632 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000140076] [ENSMUST00000155272]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000031158
Predicted Effect probably benign
Transcript: ENSMUST00000140076
AA Change: T500A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000120632
Gene: ENSMUSG00000029246
AA Change: T500A

DomainStartEndE-ValueType
Pfam:GATase_4 27 218 4e-11 PFAM
Pfam:GATase_6 74 216 1.6e-18 PFAM
Pfam:GATase_7 91 241 1.6e-16 PFAM
Pfam:Pribosyltran 309 420 1.3e-9 PFAM
low complexity region 474 482 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155272
SMART Domains Protein: ENSMUSP00000116438
Gene: ENSMUSG00000029246

DomainStartEndE-ValueType
SCOP:d1ecfa2 12 43 6e-3 SMART
Meta Mutation Damage Score 0.12 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.2%
Validation Efficiency 98% (81/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the purine/pyrimidine phosphoribosyltransferase family. It is a regulatory allosteric enzyme that catalyzes the first step of de novo purine nucleotide biosythetic pathway. This gene and PAICS/AIRC gene, a bifunctional enzyme catalyzing steps six and seven of this pathway, are located in close proximity on chromosome 4, and divergently transcribed from an intergenic region. [provided by RefSeq, Mar 2011]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T A 11: 109,953,597 E931D possibly damaging Het
Aebp1 C T 11: 5,867,911 T62I possibly damaging Het
Babam2 A T 5: 31,820,620 E139V possibly damaging Het
Bclaf1 C T 10: 20,323,063 R67* probably null Het
Bcr C A 10: 75,176,416 T51K probably benign Het
Best3 T A 10: 117,004,417 C251S probably damaging Het
Birc6 A G 17: 74,648,158 M3457V probably benign Het
C87436 C A 6: 86,445,975 T177K possibly damaging Het
Cabin1 T A 10: 75,725,560 T1036S probably benign Het
Catsperg2 C A 7: 29,713,017 V383L possibly damaging Het
Ccdc182 C T 11: 88,294,339 Q82* probably null Het
Ccl9 T C 11: 83,575,874 T76A probably damaging Het
Cdc16 G T 8: 13,781,399 C544F possibly damaging Het
Cdh18 A C 15: 23,474,216 D724A possibly damaging Het
Cdip1 G A 16: 4,770,082 P6S probably damaging Het
Col12a1 A G 9: 79,630,560 V2542A probably damaging Het
Dnajc13 G T 9: 104,184,615 T1380K possibly damaging Het
Dsg4 T A 18: 20,465,169 S715T possibly damaging Het
Dync2h1 G T 9: 6,955,986 T4132K probably benign Het
Egfem1 A T 3: 29,657,270 probably null Het
Etl4 G T 2: 20,781,015 V716L probably damaging Het
Exoc3l2 A G 7: 19,480,032 E461G unknown Het
Fam135b A G 15: 71,448,669 probably null Het
Flrt3 G T 2: 140,660,916 P264Q possibly damaging Het
Fmn2 G C 1: 174,502,453 E136D unknown Het
Fosl2 A G 5: 32,146,873 I51V probably benign Het
Foxm1 A G 6: 128,371,035 T307A probably damaging Het
Garem1 T C 18: 21,148,351 D316G possibly damaging Het
Gm13088 C A 4: 143,654,464 V330F probably damaging Het
Gm14403 A T 2: 177,508,552 H97L probably damaging Het
Gm5616 A G 9: 48,450,590 noncoding transcript Het
Hkdc1 T C 10: 62,393,810 D696G probably benign Het
Igkv1-88 C A 6: 68,862,448 W60L probably damaging Het
Iqgap3 G A 3: 88,091,592 W333* probably null Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kcnk3 G T 5: 30,622,670 V355L probably benign Het
Kmt5c A C 7: 4,746,791 K436T probably damaging Het
Lynx1 T C 15: 74,751,415 Y56C possibly damaging Het
Lypd5 T C 7: 24,353,037 S149P probably damaging Het
Map3k21 A T 8: 125,911,430 N252Y probably damaging Het
Mgat2 T C 12: 69,185,680 W343R probably damaging Het
Misp T G 10: 79,827,894 Y567* probably null Het
Mrgprb1 A T 7: 48,447,820 S115T probably benign Het
Muc16 A C 9: 18,647,146 I2617R unknown Het
Myo19 T A 11: 84,899,400 V394E probably damaging Het
Myo9b T A 8: 71,348,396 L1065Q probably benign Het
Nap1l1 A G 10: 111,495,368 D405G possibly damaging Het
Napb A T 2: 148,700,491 probably null Het
Nbas A G 12: 13,393,430 Y1162C probably benign Het
Nfam1 A T 15: 83,033,124 L36Q probably damaging Het
Nrros T C 16: 32,144,593 D202G probably damaging Het
Olfr1355 T G 10: 78,879,953 Y260* probably null Het
Olfr639 T G 7: 104,011,910 H264P probably damaging Het
Osgin2 T C 4: 15,998,908 E238G probably benign Het
Papss2 A G 19: 32,639,236 T221A probably benign Het
Pcdhga12 A C 18: 37,768,031 K639Q probably damaging Het
Pkhd1l1 T A 15: 44,489,504 probably null Het
Pmepa1 A G 2: 173,234,312 S83P possibly damaging Het
Pnp G A 14: 50,950,543 V118M probably damaging Het
Rab11fip4 A G 11: 79,690,775 N532S probably benign Het
Rbm25 A G 12: 83,671,951 D499G probably damaging Het
Rnf139 A G 15: 58,898,838 I237M possibly damaging Het
Rrp15 C T 1: 186,739,755 S85N possibly damaging Het
Sidt1 T C 16: 44,261,708 Y568C probably damaging Het
Slirp A G 12: 87,444,014 T29A probably damaging Het
Sltm G C 9: 70,586,804 E828Q probably damaging Het
Spindoc A G 19: 7,374,595 I129T probably damaging Het
Spire1 T A 18: 67,497,316 probably null Het
Styx A G 14: 45,368,452 T138A probably benign Het
Sv2c A T 13: 95,976,063 L642* probably null Het
Taf7 T C 18: 37,643,445 E23G probably damaging Het
Tcp10a A T 17: 7,345,026 T406S possibly damaging Het
Tnrc6b T A 15: 80,880,816 S840T probably benign Het
Tns3 A G 11: 8,492,245 I706T probably damaging Het
Tpsab1 A G 17: 25,345,372 V36A probably benign Het
Trafd1 T A 5: 121,373,279 D492V probably damaging Het
Trp53 A G 11: 69,587,418 E51G probably benign Het
Vdr C T 15: 97,857,596 A349T probably benign Het
Vmn2r59 T C 7: 42,046,067 D307G probably benign Het
Zfp365 C A 10: 67,897,607 V252F probably damaging Het
Zfp830 T A 11: 82,764,977 N202K probably benign Het
Other mutations in Ppat
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02545:Ppat APN 5 76915232 missense probably damaging 1.00
IGL02679:Ppat APN 5 76919469 missense probably benign 0.10
R0836:Ppat UTSW 5 76922501 missense probably benign 0.09
R2327:Ppat UTSW 5 76922467 missense possibly damaging 0.94
R2850:Ppat UTSW 5 76919375 missense probably benign
R3434:Ppat UTSW 5 76918065 missense probably damaging 0.99
R4301:Ppat UTSW 5 76928501 intron probably benign
R4422:Ppat UTSW 5 76915214 missense probably damaging 1.00
R4423:Ppat UTSW 5 76915214 missense probably damaging 1.00
R4424:Ppat UTSW 5 76915214 missense probably damaging 1.00
R4839:Ppat UTSW 5 76950964 nonsense probably null
R4872:Ppat UTSW 5 76926793 missense probably damaging 0.99
R5007:Ppat UTSW 5 76928678 intron probably benign
R5010:Ppat UTSW 5 76928678 intron probably benign
R5325:Ppat UTSW 5 76928422 intron probably benign
R6209:Ppat UTSW 5 76918146 missense probably benign 0.00
R6225:Ppat UTSW 5 76922355 missense probably damaging 0.99
R6287:Ppat UTSW 5 76918214 nonsense probably null
R7367:Ppat UTSW 5 76919864 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCTGCATTCCATGTAATCTTCAGG -3'
(R):5'- GGTGAGACATGTTTTCCCTTCC -3'

Sequencing Primer
(F):5'- ACCTCAGAAAATCTCAAAGCTTAAAG -3'
(R):5'- GAGACATGTTTTCCCTTCCTCCTG -3'
Posted On2017-06-26