Incidental Mutation 'R5982:Dync2h1'
ID481459
Institutional Source Beutler Lab
Gene Symbol Dync2h1
Ensembl Gene ENSMUSG00000047193
Gene Namedynein cytoplasmic 2 heavy chain 1
Synonyms4432416O06Rik, DHC2, D030010H02Rik, D330044F14Rik, Dnchc2, DHC1b, b2b414Clo
MMRRC Submission 044163-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5982 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location6928503-7184446 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 6955986 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 4132 (T4132K)
Ref Sequence ENSEMBL: ENSMUSP00000116679 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048417] [ENSMUST00000140466] [ENSMUST00000147193]
Predicted Effect probably benign
Transcript: ENSMUST00000048417
AA Change: T4125K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000046733
Gene: ENSMUSG00000047193
AA Change: T4125K

DomainStartEndE-ValueType
Pfam:DHC_N1 187 676 1.6e-43 PFAM
Pfam:DHC_N2 1117 1523 4.1e-120 PFAM
AAA 1684 1830 3.72e-2 SMART
AAA 1971 2127 2.18e0 SMART
AAA 2283 2431 1.66e0 SMART
low complexity region 2588 2602 N/A INTRINSIC
Pfam:AAA_8 2618 2881 6.8e-27 PFAM
Pfam:MT 2894 3230 5.4e-28 PFAM
Pfam:AAA_9 3242 3471 1.1e-50 PFAM
Pfam:Dynein_heavy 3605 4304 2.3e-136 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140466
AA Change: T4125K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000120007
Gene: ENSMUSG00000047193
AA Change: T4125K

DomainStartEndE-ValueType
Pfam:DHC_N1 187 676 1.6e-43 PFAM
Pfam:DHC_N2 1117 1523 4.1e-120 PFAM
AAA 1684 1830 3.72e-2 SMART
AAA 1971 2127 2.18e0 SMART
AAA 2283 2431 1.66e0 SMART
low complexity region 2588 2602 N/A INTRINSIC
Pfam:AAA_8 2618 2881 6.8e-27 PFAM
Pfam:MT 2894 3230 5.4e-28 PFAM
Pfam:AAA_9 3242 3471 1.1e-50 PFAM
Pfam:Dynein_heavy 3605 4304 2.3e-136 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147193
AA Change: T4132K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000116679
Gene: ENSMUSG00000047193
AA Change: T4132K

DomainStartEndE-ValueType
Pfam:DHC_N1 188 674 4e-45 PFAM
Pfam:DHC_N2 1118 1521 5.5e-111 PFAM
AAA 1684 1830 3.72e-2 SMART
AAA 1971 2127 2.18e0 SMART
AAA 2283 2431 1.66e0 SMART
low complexity region 2588 2602 N/A INTRINSIC
Pfam:AAA_8 2618 2880 4.4e-27 PFAM
Pfam:MT 2894 3230 1.3e-27 PFAM
Pfam:AAA_9 3246 3477 1e-79 PFAM
Pfam:Dynein_heavy 3618 4310 8.5e-158 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152934
Meta Mutation Damage Score 0.1616 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.2%
Validation Efficiency 98% (81/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large cytoplasmic dynein protein that is involved in retrograde transport in the cilium and has a role in intraflagellar transport, a process required for ciliary/flagellar assembly. Mutations in this gene cause a heterogeneous spectrum of conditions related to altered primary cilium function and often involve polydactyly, abnormal skeletogenesis, and polycystic kidneys. Alternative splicing results in multiple transcript variants encoding distinct proteins. [provided by RefSeq, Jan 2010]
PHENOTYPE: Homozygotes for a gene trap allele show complete embryonic lethality with altered heart looping and brain morphology. Chemically induced mutants show randomized heart looping and polydactyly. Holoprosencephaly or exencephaly, micrognathia, and cardiac, renal, airway and eye defects may be observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T A 11: 109,953,597 E931D possibly damaging Het
Aebp1 C T 11: 5,867,911 T62I possibly damaging Het
Babam2 A T 5: 31,820,620 E139V possibly damaging Het
Bclaf1 C T 10: 20,323,063 R67* probably null Het
Bcr C A 10: 75,176,416 T51K probably benign Het
Best3 T A 10: 117,004,417 C251S probably damaging Het
Birc6 A G 17: 74,648,158 M3457V probably benign Het
C87436 C A 6: 86,445,975 T177K possibly damaging Het
Cabin1 T A 10: 75,725,560 T1036S probably benign Het
Catsperg2 C A 7: 29,713,017 V383L possibly damaging Het
Ccdc182 C T 11: 88,294,339 Q82* probably null Het
Ccl9 T C 11: 83,575,874 T76A probably damaging Het
Cdc16 G T 8: 13,781,399 C544F possibly damaging Het
Cdh18 A C 15: 23,474,216 D724A possibly damaging Het
Cdip1 G A 16: 4,770,082 P6S probably damaging Het
Col12a1 A G 9: 79,630,560 V2542A probably damaging Het
Dnajc13 G T 9: 104,184,615 T1380K possibly damaging Het
Dsg4 T A 18: 20,465,169 S715T possibly damaging Het
Egfem1 A T 3: 29,657,270 probably null Het
Etl4 G T 2: 20,781,015 V716L probably damaging Het
Exoc3l2 A G 7: 19,480,032 E461G unknown Het
Fam135b A G 15: 71,448,669 probably null Het
Flrt3 G T 2: 140,660,916 P264Q possibly damaging Het
Fmn2 G C 1: 174,502,453 E136D unknown Het
Fosl2 A G 5: 32,146,873 I51V probably benign Het
Foxm1 A G 6: 128,371,035 T307A probably damaging Het
Garem1 T C 18: 21,148,351 D316G possibly damaging Het
Gm13088 C A 4: 143,654,464 V330F probably damaging Het
Gm14403 A T 2: 177,508,552 H97L probably damaging Het
Gm5616 A G 9: 48,450,590 noncoding transcript Het
Hkdc1 T C 10: 62,393,810 D696G probably benign Het
Igkv1-88 C A 6: 68,862,448 W60L probably damaging Het
Iqgap3 G A 3: 88,091,592 W333* probably null Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kcnk3 G T 5: 30,622,670 V355L probably benign Het
Kmt5c A C 7: 4,746,791 K436T probably damaging Het
Lynx1 T C 15: 74,751,415 Y56C possibly damaging Het
Lypd5 T C 7: 24,353,037 S149P probably damaging Het
Map3k21 A T 8: 125,911,430 N252Y probably damaging Het
Mgat2 T C 12: 69,185,680 W343R probably damaging Het
Misp T G 10: 79,827,894 Y567* probably null Het
Mrgprb1 A T 7: 48,447,820 S115T probably benign Het
Muc16 A C 9: 18,647,146 I2617R unknown Het
Myo19 T A 11: 84,899,400 V394E probably damaging Het
Myo9b T A 8: 71,348,396 L1065Q probably benign Het
Nap1l1 A G 10: 111,495,368 D405G possibly damaging Het
Napb A T 2: 148,700,491 probably null Het
Nbas A G 12: 13,393,430 Y1162C probably benign Het
Nfam1 A T 15: 83,033,124 L36Q probably damaging Het
Nrros T C 16: 32,144,593 D202G probably damaging Het
Olfr1355 T G 10: 78,879,953 Y260* probably null Het
Olfr639 T G 7: 104,011,910 H264P probably damaging Het
Osgin2 T C 4: 15,998,908 E238G probably benign Het
Papss2 A G 19: 32,639,236 T221A probably benign Het
Pcdhga12 A C 18: 37,768,031 K639Q probably damaging Het
Pkhd1l1 T A 15: 44,489,504 probably null Het
Pmepa1 A G 2: 173,234,312 S83P possibly damaging Het
Pnp G A 14: 50,950,543 V118M probably damaging Het
Ppat T C 5: 76,915,265 T500A probably benign Het
Rab11fip4 A G 11: 79,690,775 N532S probably benign Het
Rbm25 A G 12: 83,671,951 D499G probably damaging Het
Rnf139 A G 15: 58,898,838 I237M possibly damaging Het
Rrp15 C T 1: 186,739,755 S85N possibly damaging Het
Sidt1 T C 16: 44,261,708 Y568C probably damaging Het
Slirp A G 12: 87,444,014 T29A probably damaging Het
Sltm G C 9: 70,586,804 E828Q probably damaging Het
Spindoc A G 19: 7,374,595 I129T probably damaging Het
Spire1 T A 18: 67,497,316 probably null Het
Styx A G 14: 45,368,452 T138A probably benign Het
Sv2c A T 13: 95,976,063 L642* probably null Het
Taf7 T C 18: 37,643,445 E23G probably damaging Het
Tcp10a A T 17: 7,345,026 T406S possibly damaging Het
Tnrc6b T A 15: 80,880,816 S840T probably benign Het
Tns3 A G 11: 8,492,245 I706T probably damaging Het
Tpsab1 A G 17: 25,345,372 V36A probably benign Het
Trafd1 T A 5: 121,373,279 D492V probably damaging Het
Trp53 A G 11: 69,587,418 E51G probably benign Het
Vdr C T 15: 97,857,596 A349T probably benign Het
Vmn2r59 T C 7: 42,046,067 D307G probably benign Het
Zfp365 C A 10: 67,897,607 V252F probably damaging Het
Zfp830 T A 11: 82,764,977 N202K probably benign Het
Other mutations in Dync2h1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Dync2h1 APN 9 7158839 missense probably benign 0.42
IGL00310:Dync2h1 APN 9 7155072 splice site probably benign
IGL00499:Dync2h1 APN 9 7168700 missense possibly damaging 0.95
IGL00579:Dync2h1 APN 9 7035728 splice site probably benign
IGL00660:Dync2h1 APN 9 7075797 missense probably damaging 0.98
IGL00964:Dync2h1 APN 9 7174881 splice site probably benign
IGL01025:Dync2h1 APN 9 7162789 missense probably damaging 1.00
IGL01093:Dync2h1 APN 9 7145611 missense probably benign 0.01
IGL01108:Dync2h1 APN 9 7176771 missense possibly damaging 0.87
IGL01126:Dync2h1 APN 9 7116588 missense probably benign 0.00
IGL01474:Dync2h1 APN 9 7102493 missense probably benign 0.01
IGL01531:Dync2h1 APN 9 7071111 missense probably benign 0.11
IGL01548:Dync2h1 APN 9 7071922 missense probably damaging 1.00
IGL01621:Dync2h1 APN 9 7140897 critical splice donor site probably null
IGL01672:Dync2h1 APN 9 7118884 nonsense probably null
IGL01681:Dync2h1 APN 9 7142196 splice site probably null
IGL01685:Dync2h1 APN 9 7142297 missense probably damaging 1.00
IGL01724:Dync2h1 APN 9 7081077 missense probably benign 0.03
IGL01738:Dync2h1 APN 9 7114922 missense possibly damaging 0.77
IGL01783:Dync2h1 APN 9 7118822 unclassified probably benign
IGL01813:Dync2h1 APN 9 7122799 missense probably damaging 1.00
IGL01931:Dync2h1 APN 9 7114973 missense probably damaging 1.00
IGL01931:Dync2h1 APN 9 7011207 missense probably benign 0.33
IGL02105:Dync2h1 APN 9 7075892 missense probably damaging 1.00
IGL02137:Dync2h1 APN 9 7134349 missense probably benign
IGL02140:Dync2h1 APN 9 7147791 missense probably benign
IGL02175:Dync2h1 APN 9 7111548 missense possibly damaging 0.91
IGL02283:Dync2h1 APN 9 7125912 missense probably damaging 0.99
IGL02305:Dync2h1 APN 9 7122678 missense probably benign
IGL02342:Dync2h1 APN 9 7142246 missense probably damaging 1.00
IGL02367:Dync2h1 APN 9 7158926 missense probably damaging 0.98
IGL02458:Dync2h1 APN 9 7117422 missense probably damaging 1.00
IGL02563:Dync2h1 APN 9 7035700 missense possibly damaging 0.95
IGL02825:Dync2h1 APN 9 6955901 splice site probably benign
IGL02955:Dync2h1 APN 9 7142864 missense probably benign 0.00
IGL02992:Dync2h1 APN 9 7137074 missense probably benign 0.01
IGL02996:Dync2h1 APN 9 6935279 missense probably damaging 0.99
IGL03224:Dync2h1 APN 9 7076235 missense probably benign 0.32
IGL03226:Dync2h1 APN 9 7125918 missense probably benign
IGL03233:Dync2h1 APN 9 7101525 missense possibly damaging 0.90
R0016:Dync2h1 UTSW 9 7144346 splice site probably benign
R0016:Dync2h1 UTSW 9 7144346 splice site probably benign
R0043:Dync2h1 UTSW 9 7005574 missense probably benign 0.05
R0109:Dync2h1 UTSW 9 7111487 missense probably damaging 1.00
R0109:Dync2h1 UTSW 9 7111487 missense probably damaging 1.00
R0121:Dync2h1 UTSW 9 7001327 splice site probably benign
R0277:Dync2h1 UTSW 9 7129046 missense probably benign
R0360:Dync2h1 UTSW 9 7113182 missense possibly damaging 0.62
R0362:Dync2h1 UTSW 9 7005487 splice site probably null
R0389:Dync2h1 UTSW 9 7167244 splice site probably null
R0443:Dync2h1 UTSW 9 7167244 splice site probably null
R0496:Dync2h1 UTSW 9 7155180 missense probably benign 0.42
R0506:Dync2h1 UTSW 9 7113153 missense probably benign 0.05
R0511:Dync2h1 UTSW 9 7122692 missense probably benign 0.00
R0540:Dync2h1 UTSW 9 7051480 missense probably benign 0.00
R0550:Dync2h1 UTSW 9 7120954 intron probably null
R0564:Dync2h1 UTSW 9 7139432 missense probably damaging 1.00
R0607:Dync2h1 UTSW 9 7051480 missense probably benign 0.00
R0699:Dync2h1 UTSW 9 7103680 missense probably benign 0.00
R0725:Dync2h1 UTSW 9 7015497 missense possibly damaging 0.93
R0835:Dync2h1 UTSW 9 7116642 critical splice acceptor site probably null
R0837:Dync2h1 UTSW 9 7077979 missense probably benign 0.07
R0894:Dync2h1 UTSW 9 7041734 splice site probably benign
R0938:Dync2h1 UTSW 9 7002658 missense probably benign 0.02
R1056:Dync2h1 UTSW 9 7147731 missense probably benign 0.15
R1081:Dync2h1 UTSW 9 7005488 critical splice donor site probably null
R1178:Dync2h1 UTSW 9 7101193 splice site probably benign
R1243:Dync2h1 UTSW 9 7120882 missense probably benign
R1295:Dync2h1 UTSW 9 7075752 splice site probably benign
R1304:Dync2h1 UTSW 9 7102318 missense probably damaging 1.00
R1387:Dync2h1 UTSW 9 7125816 missense probably benign
R1513:Dync2h1 UTSW 9 7103663 missense possibly damaging 0.74
R1557:Dync2h1 UTSW 9 7140911 missense probably damaging 1.00
R1568:Dync2h1 UTSW 9 7157553 missense probably null 0.02
R1570:Dync2h1 UTSW 9 7176926 missense probably benign 0.12
R1670:Dync2h1 UTSW 9 6993942 missense possibly damaging 0.82
R1713:Dync2h1 UTSW 9 7131891 missense probably benign
R1766:Dync2h1 UTSW 9 7015526 critical splice acceptor site probably null
R1773:Dync2h1 UTSW 9 7128256 missense probably damaging 1.00
R1786:Dync2h1 UTSW 9 7081084 missense probably damaging 1.00
R1848:Dync2h1 UTSW 9 7049166 missense probably benign 0.01
R1850:Dync2h1 UTSW 9 7001448 missense probably benign 0.00
R1935:Dync2h1 UTSW 9 7139159 critical splice donor site probably null
R1936:Dync2h1 UTSW 9 7139159 critical splice donor site probably null
R1937:Dync2h1 UTSW 9 7139159 critical splice donor site probably null
R1939:Dync2h1 UTSW 9 7139159 critical splice donor site probably null
R1940:Dync2h1 UTSW 9 7139159 critical splice donor site probably null
R1944:Dync2h1 UTSW 9 7001377 missense probably damaging 1.00
R1976:Dync2h1 UTSW 9 7129045 missense probably benign
R2012:Dync2h1 UTSW 9 7169589 missense probably benign 0.00
R2020:Dync2h1 UTSW 9 7122772 missense probably damaging 0.99
R2020:Dync2h1 UTSW 9 7162925 missense probably benign 0.25
R2024:Dync2h1 UTSW 9 7129062 missense probably damaging 0.97
R2038:Dync2h1 UTSW 9 6967226 missense probably damaging 0.99
R2045:Dync2h1 UTSW 9 7160171 missense probably damaging 1.00
R2060:Dync2h1 UTSW 9 7162802 missense possibly damaging 0.92
R2094:Dync2h1 UTSW 9 7148735 missense probably benign 0.18
R2129:Dync2h1 UTSW 9 7175289 missense possibly damaging 0.94
R2130:Dync2h1 UTSW 9 7011253 missense probably damaging 1.00
R2136:Dync2h1 UTSW 9 7122772 missense probably damaging 0.99
R2164:Dync2h1 UTSW 9 7124797 missense probably damaging 1.00
R2242:Dync2h1 UTSW 9 7037828 splice site probably null
R2255:Dync2h1 UTSW 9 6955905 critical splice donor site probably null
R2357:Dync2h1 UTSW 9 7081053 missense probably benign 0.03
R2389:Dync2h1 UTSW 9 7122618 missense possibly damaging 0.82
R2412:Dync2h1 UTSW 9 7144246 missense probably benign 0.01
R2885:Dync2h1 UTSW 9 7102329 missense probably damaging 1.00
R2909:Dync2h1 UTSW 9 7049114 missense probably damaging 1.00
R3434:Dync2h1 UTSW 9 7011236 missense probably benign
R3719:Dync2h1 UTSW 9 7006882 splice site probably benign
R3723:Dync2h1 UTSW 9 7041658 missense probably benign 0.17
R3800:Dync2h1 UTSW 9 7101525 missense possibly damaging 0.90
R3803:Dync2h1 UTSW 9 6935293 missense probably benign 0.00
R3936:Dync2h1 UTSW 9 7001482 missense probably damaging 1.00
R3941:Dync2h1 UTSW 9 7124825 missense probably benign
R3950:Dync2h1 UTSW 9 7112061 nonsense probably null
R4004:Dync2h1 UTSW 9 7117404 missense probably damaging 1.00
R4091:Dync2h1 UTSW 9 7131881 missense probably benign 0.01
R4233:Dync2h1 UTSW 9 7134360 missense probably benign 0.02
R4302:Dync2h1 UTSW 9 7077880 missense probably benign 0.02
R4451:Dync2h1 UTSW 9 6983477 missense probably benign 0.02
R4512:Dync2h1 UTSW 9 7085009 nonsense probably null
R4596:Dync2h1 UTSW 9 6992595 missense probably benign
R4604:Dync2h1 UTSW 9 7140995 missense probably benign 0.00
R4614:Dync2h1 UTSW 9 7011290 missense probably benign 0.03
R4667:Dync2h1 UTSW 9 7051411 missense probably benign 0.00
R4671:Dync2h1 UTSW 9 7169640 missense possibly damaging 0.82
R4714:Dync2h1 UTSW 9 7118932 missense possibly damaging 0.86
R4716:Dync2h1 UTSW 9 7142648 critical splice donor site probably null
R4736:Dync2h1 UTSW 9 7006862 missense probably benign 0.00
R4807:Dync2h1 UTSW 9 7139422 missense probably benign 0.31
R4850:Dync2h1 UTSW 9 7134364 missense probably benign 0.14
R4862:Dync2h1 UTSW 9 7147717 missense probably benign
R4899:Dync2h1 UTSW 9 7131921 nonsense probably null
R4971:Dync2h1 UTSW 9 7131949 missense probably benign
R5040:Dync2h1 UTSW 9 6992625 missense probably benign 0.09
R5054:Dync2h1 UTSW 9 7085007 missense possibly damaging 0.63
R5274:Dync2h1 UTSW 9 7116540 missense probably benign 0.00
R5307:Dync2h1 UTSW 9 7155099 missense probably damaging 1.00
R5347:Dync2h1 UTSW 9 7129727 missense probably damaging 1.00
R5372:Dync2h1 UTSW 9 7176962 unclassified probably benign
R5384:Dync2h1 UTSW 9 7016791 missense probably damaging 0.99
R5385:Dync2h1 UTSW 9 7016791 missense probably damaging 0.99
R5394:Dync2h1 UTSW 9 7120899 nonsense probably null
R5402:Dync2h1 UTSW 9 7114949 missense probably damaging 1.00
R5446:Dync2h1 UTSW 9 7144217 missense probably benign
R5538:Dync2h1 UTSW 9 7168630 intron probably benign
R5551:Dync2h1 UTSW 9 7031718 missense possibly damaging 0.74
R5619:Dync2h1 UTSW 9 7118885 missense probably benign 0.02
R5621:Dync2h1 UTSW 9 7120909 missense possibly damaging 0.86
R5652:Dync2h1 UTSW 9 7116638 missense probably benign 0.45
R5655:Dync2h1 UTSW 9 7148659 missense probably benign 0.01
R5689:Dync2h1 UTSW 9 7169689 missense probably damaging 1.00
R5725:Dync2h1 UTSW 9 7169528 missense probably benign 0.21
R5742:Dync2h1 UTSW 9 7165762 missense possibly damaging 0.64
R5817:Dync2h1 UTSW 9 6996905 missense probably damaging 1.00
R5852:Dync2h1 UTSW 9 7011290 missense probably benign 0.03
R5898:Dync2h1 UTSW 9 7148717 missense probably benign 0.00
R5916:Dync2h1 UTSW 9 7102309 critical splice donor site probably null
R5939:Dync2h1 UTSW 9 7037801 missense probably damaging 0.99
R5942:Dync2h1 UTSW 9 7117466 nonsense probably null
R6029:Dync2h1 UTSW 9 7157646 missense probably benign
R6125:Dync2h1 UTSW 9 7168706 missense probably damaging 1.00
R6209:Dync2h1 UTSW 9 7165677 missense probably benign 0.01
R6247:Dync2h1 UTSW 9 7135078 missense probably damaging 1.00
R6294:Dync2h1 UTSW 9 7084986 missense probably benign 0.01
R6328:Dync2h1 UTSW 9 7165717 missense probably benign 0.00
R6376:Dync2h1 UTSW 9 7165703 missense probably benign 0.21
R6394:Dync2h1 UTSW 9 7168331 missense probably damaging 0.99
R6539:Dync2h1 UTSW 9 7159478 splice site probably null
R6554:Dync2h1 UTSW 9 7037699 missense probably benign 0.39
R6559:Dync2h1 UTSW 9 7139501 missense possibly damaging 0.72
R6563:Dync2h1 UTSW 9 7120819 missense probably benign 0.27
R6807:Dync2h1 UTSW 9 7041718 missense probably benign 0.10
R6848:Dync2h1 UTSW 9 7159632 missense probably benign 0.22
R6901:Dync2h1 UTSW 9 7131855 missense probably damaging 1.00
R6921:Dync2h1 UTSW 9 7102549 missense probably benign
R6997:Dync2h1 UTSW 9 7168743 missense probably null 0.00
R7084:Dync2h1 UTSW 9 7113214 missense possibly damaging 0.72
R7113:Dync2h1 UTSW 9 7075788 missense probably benign 0.03
R7131:Dync2h1 UTSW 9 7075786 missense probably damaging 1.00
R7165:Dync2h1 UTSW 9 7050479 missense probably benign
R7196:Dync2h1 UTSW 9 7147715 nonsense probably null
R7208:Dync2h1 UTSW 9 7141059 missense probably damaging 1.00
R7225:Dync2h1 UTSW 9 7142756 missense probably benign
R7237:Dync2h1 UTSW 9 6993966 missense probably benign 0.00
R7243:Dync2h1 UTSW 9 7102405 missense possibly damaging 0.64
R7291:Dync2h1 UTSW 9 6929590 missense possibly damaging 0.69
R7293:Dync2h1 UTSW 9 7001454 missense possibly damaging 0.88
X0009:Dync2h1 UTSW 9 7117576 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- TGAAAGATGCCATCCTTCTCAC -3'
(R):5'- ATTCAGGTTCTCCTTGCACAGC -3'

Sequencing Primer
(F):5'- AGATGCCATCCTTCTCACTACTAAGG -3'
(R):5'- TTGCACAGCCTACCTGCAG -3'
Posted On2017-06-26