Incidental Mutation 'R0514:Dnah5'
ID48146
Institutional Source Beutler Lab
Gene Symbol Dnah5
Ensembl Gene ENSMUSG00000022262
Gene Namedynein, axonemal, heavy chain 5
Synonymsb2b1565Clo, b2b1134Clo, Mdnah5, b2b1537Clo, b2b1154Clo, Dnahc5
MMRRC Submission 038708-MU
Accession Numbers

NCBI RefSeq: NM_133365.3; MGI: 107718

Is this an essential gene? Probably essential (E-score: 0.830) question?
Stock #R0514 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location28203752-28472052 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 28366321 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 2727 (T2727A)
Ref Sequence ENSEMBL: ENSMUSP00000069751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067048]
Predicted Effect probably damaging
Transcript: ENSMUST00000067048
AA Change: T2727A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000069751
Gene: ENSMUSG00000022262
AA Change: T2727A

DomainStartEndE-ValueType
Pfam:DHC_N1 247 802 2.3e-163 PFAM
low complexity region 1077 1088 N/A INTRINSIC
low complexity region 1113 1128 N/A INTRINSIC
Pfam:DHC_N2 1399 1807 2.3e-134 PFAM
AAA 1972 2108 2e-3 SMART
AAA 2251 2424 4.3e-3 SMART
AAA 2579 2777 2.2e-3 SMART
low complexity region 2874 2889 N/A INTRINSIC
Pfam:AAA_8 2914 3186 3.2e-70 PFAM
Pfam:MT 3198 3546 1e-44 PFAM
Pfam:AAA_9 3567 3792 1.4e-86 PFAM
low complexity region 3889 3899 N/A INTRINSIC
Pfam:Dynein_heavy 3930 4618 4.4e-246 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype Strain: 2180081
Lethality: D14-D21
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a dynein protein, which is part of a microtubule-associated motor protein complex consisting of heavy, light, and intermediate chains. This protein is an axonemal heavy chain dynein. It functions as a force-generating protein with ATPase activity, whereby the release of ADP is thought to produce the force-producing power stroke. Mutations in this gene cause primary ciliary dyskinesia type 3, as well as Kartagener syndrome, which are both diseases due to ciliary defects. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a disruption in this gene display postnatal lethality, hydrocephalus, respiratory infections, situs inversus and ciliary immotility. [provided by MGI curators]
Allele List at MGI

All alleles(11) : Targeted(2) Gene trapped(1) Transgenic(1) Chemically induced(7)

Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acpp T A 9: 104,319,978 Y154F probably damaging Het
Acsl6 A T 11: 54,350,580 D579V probably damaging Het
Adamts18 C T 8: 113,738,769 probably null Het
Adamts20 A T 15: 94,270,376 V1882D probably damaging Het
Add3 A T 19: 53,236,843 K465* probably null Het
Ago1 T G 4: 126,439,595 I524L probably benign Het
Akr1c18 A G 13: 4,137,191 M208T probably benign Het
Anapc1 C A 2: 128,632,655 L1413F probably damaging Het
Arid4b A T 13: 14,184,317 D646V probably damaging Het
Arnt2 T C 7: 84,304,859 E261G probably benign Het
Bccip C T 7: 133,719,130 T211I possibly damaging Het
Bsn T C 9: 108,125,782 S475G probably benign Het
Cdh26 G A 2: 178,466,828 probably null Het
Ceacam2 A G 7: 25,520,931 F414S probably benign Het
Cfb T C 17: 34,860,898 R172G probably damaging Het
Cntnap5b A C 1: 99,772,786 T8P probably benign Het
Cpne9 A T 6: 113,290,013 I136L probably damaging Het
Crtc1 A T 8: 70,402,429 probably null Het
Dcdc2a A T 13: 25,119,386 H300L probably benign Het
Dhdh C T 7: 45,488,706 V20M probably benign Het
Dhx34 T C 7: 16,210,537 Q584R probably benign Het
Dis3l2 A G 1: 87,047,092 Y701C probably damaging Het
Dmrt2 T C 19: 25,675,655 probably null Het
Dopey1 A G 9: 86,520,734 E1329G probably damaging Het
Evpl A G 11: 116,223,291 V1191A probably damaging Het
Fam198a A G 9: 121,978,352 T521A possibly damaging Het
Fgfr1op A G 17: 8,191,434 N342S possibly damaging Het
Fhl4 T C 10: 85,098,386 D177G probably damaging Het
Heg1 A G 16: 33,726,756 T662A possibly damaging Het
Ifih1 A G 2: 62,623,391 probably null Het
Il13 T C 11: 53,632,518 R87G possibly damaging Het
Kcnc3 T A 7: 44,595,928 Y547* probably null Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Lama1 G A 17: 67,764,698 G860D probably benign Het
Lmo7 T C 14: 101,887,173 L356P probably damaging Het
Lmo7 A T 14: 101,896,559 K447I probably damaging Het
Lrp2bp A G 8: 46,011,958 H38R probably damaging Het
Magi3 G A 3: 104,015,022 P1460S probably damaging Het
Megf8 T A 7: 25,364,303 C2695S possibly damaging Het
Mrgprb2 T G 7: 48,551,970 S336R probably benign Het
Mrgprx2 C T 7: 48,482,964 M1I probably null Het
Mug2 T C 6: 122,081,599 L1320P probably damaging Het
Noxred1 A G 12: 87,227,064 S68P probably benign Het
Olfr504 T A 7: 108,565,672 Y41F probably damaging Het
Olfr561 T A 7: 102,775,332 H269Q probably benign Het
Os9 C T 10: 127,119,639 C123Y probably damaging Het
Ostf1 T A 19: 18,596,359 T42S probably benign Het
Parg C A 14: 32,254,560 T186K possibly damaging Het
Pcnx T A 12: 81,995,110 M2172K probably benign Het
Pip4k2a A G 2: 18,845,936 I360T probably damaging Het
Pkn2 T C 3: 142,810,458 D568G possibly damaging Het
Plch2 A G 4: 154,998,886 S431P probably damaging Het
Prl8a6 A T 13: 27,433,007 C233* probably null Het
Prox1 G A 1: 190,161,456 T264I probably damaging Het
Prr5 A G 15: 84,702,766 N248S probably benign Het
Psip1 A C 4: 83,460,037 S407R probably damaging Het
Rab32 A T 10: 10,550,896 V102E probably damaging Het
Rap1gap2 T G 11: 74,388,854 K687Q possibly damaging Het
Rbak A T 5: 143,173,414 V628E probably damaging Het
Rnf148 T C 6: 23,654,793 E68G possibly damaging Het
Rnf212 A T 5: 108,749,442 S3T probably damaging Het
Rrad T G 8: 104,628,627 I250L probably benign Het
Sall4 T C 2: 168,755,705 H405R probably damaging Het
Scn9a T C 2: 66,483,678 R1888G probably damaging Het
Setd5 G T 6: 113,119,437 E535* probably null Het
Slc20a1 C T 2: 129,199,891 S58L probably damaging Het
Slc31a1 A G 4: 62,385,604 probably benign Het
Slc38a11 G T 2: 65,316,865 Q423K probably benign Het
Snrpd1 A T 18: 10,626,846 T38S possibly damaging Het
Taar4 A G 10: 23,960,882 D130G probably damaging Het
Tfb2m C T 1: 179,531,304 R338H probably benign Het
Tm2d2 A G 8: 25,022,726 I197V possibly damaging Het
Tmem132a C T 19: 10,858,991 G725D probably damaging Het
Tmem67 T C 4: 12,089,317 T38A probably benign Het
Tmprss15 A T 16: 78,968,267 S816T probably benign Het
Tnfrsf11a A G 1: 105,826,992 E263G probably damaging Het
Tnfrsf17 C T 16: 11,315,327 L90F probably benign Het
Tpr A G 1: 150,402,273 K117E possibly damaging Het
Trim43a C T 9: 88,584,336 Q5* probably null Het
Ubn1 A T 16: 5,073,071 D498V probably damaging Het
Vipr1 T A 9: 121,658,049 C63S probably damaging Het
Vmn1r237 T A 17: 21,314,670 H218Q possibly damaging Het
Vmn2r100 C A 17: 19,522,120 P252Q possibly damaging Het
Vmn2r95 T C 17: 18,451,582 V527A probably benign Het
Vmn2r97 A T 17: 18,914,472 T51S probably benign Het
Vwa8 G A 14: 78,947,189 V376I probably benign Het
Wdfy4 T A 14: 33,080,775 T1838S probably benign Het
Zcwpw1 A T 5: 137,796,683 E47V probably benign Het
Zeb2 T C 2: 45,002,647 E130G possibly damaging Het
Zfp111 A G 7: 24,199,143 Y348H probably damaging Het
Zfp53 T C 17: 21,509,009 S435P probably damaging Het
Other mutations in Dnah5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Dnah5 APN 15 28272342 missense probably benign
IGL00331:Dnah5 APN 15 28421620 missense probably damaging 1.00
IGL00519:Dnah5 APN 15 28444218 missense probably benign 0.10
IGL00537:Dnah5 APN 15 28458702 critical splice donor site probably null
IGL01102:Dnah5 APN 15 28410003 critical splice donor site probably null
IGL01126:Dnah5 APN 15 28302399 missense possibly damaging 0.85
IGL01154:Dnah5 APN 15 28458656 missense possibly damaging 0.75
IGL01349:Dnah5 APN 15 28294913 splice site probably benign
IGL01353:Dnah5 APN 15 28233272 missense probably benign 0.00
IGL01372:Dnah5 APN 15 28230490 missense probably benign 0.00
IGL01390:Dnah5 APN 15 28411540 missense probably benign 0.00
IGL01446:Dnah5 APN 15 28326669 missense probably damaging 1.00
IGL01472:Dnah5 APN 15 28331726 missense probably damaging 1.00
IGL01485:Dnah5 APN 15 28331726 missense probably damaging 1.00
IGL01568:Dnah5 APN 15 28229652 missense probably benign 0.01
IGL01592:Dnah5 APN 15 28236637 missense probably benign 0.01
IGL01594:Dnah5 APN 15 28311334 missense possibly damaging 0.87
IGL01677:Dnah5 APN 15 28367782 missense probably damaging 1.00
IGL01845:Dnah5 APN 15 28449169 missense probably benign 0.06
IGL01904:Dnah5 APN 15 28307364 missense probably benign 0.09
IGL01913:Dnah5 APN 15 28313753 missense possibly damaging 0.50
IGL01950:Dnah5 APN 15 28290289 missense probably null 1.00
IGL01963:Dnah5 APN 15 28370536 missense probably benign 0.12
IGL02008:Dnah5 APN 15 28343552 missense probably damaging 0.98
IGL02088:Dnah5 APN 15 28459118 critical splice acceptor site probably null
IGL02090:Dnah5 APN 15 28240041 splice site probably benign
IGL02114:Dnah5 APN 15 28397124 missense probably damaging 0.97
IGL02135:Dnah5 APN 15 28247885 missense possibly damaging 0.50
IGL02232:Dnah5 APN 15 28299240 missense probably damaging 1.00
IGL02386:Dnah5 APN 15 28340381 missense probably damaging 1.00
IGL02475:Dnah5 APN 15 28219150 missense probably benign 0.09
IGL02626:Dnah5 APN 15 28307276 missense possibly damaging 0.94
IGL02650:Dnah5 APN 15 28289047 splice site probably benign
IGL02651:Dnah5 APN 15 28350622 missense probably benign 0.05
IGL02652:Dnah5 APN 15 28366187 missense probably damaging 0.99
IGL02670:Dnah5 APN 15 28409296 missense probably damaging 1.00
IGL02697:Dnah5 APN 15 28445143 missense probably benign 0.00
IGL02721:Dnah5 APN 15 28234243 critical splice acceptor site probably null
IGL02858:Dnah5 APN 15 28453212 missense possibly damaging 0.65
IGL02859:Dnah5 APN 15 28383625 missense probably benign 0.01
IGL02945:Dnah5 APN 15 28270426 missense probably benign 0.00
IGL02949:Dnah5 APN 15 28272185 missense probably benign 0.32
IGL02971:Dnah5 APN 15 28384461 missense probably damaging 1.00
IGL03017:Dnah5 APN 15 28340325 missense possibly damaging 0.93
IGL03177:Dnah5 APN 15 28295399 missense probably damaging 0.97
IGL03212:Dnah5 APN 15 28290163 missense probably benign 0.08
IGL03224:Dnah5 APN 15 28459154 missense probably damaging 1.00
IGL03231:Dnah5 APN 15 28311148 missense probably damaging 1.00
IGL03273:Dnah5 APN 15 28458649 missense probably damaging 0.98
IGL03294:Dnah5 APN 15 28233295 critical splice donor site probably null
IGL03331:Dnah5 APN 15 28419940 missense probably damaging 1.00
IGL03337:Dnah5 APN 15 28290141 missense probably benign 0.10
IGL03367:Dnah5 APN 15 28234327 missense possibly damaging 0.95
IGL02837:Dnah5 UTSW 15 28269400 missense probably benign
P0008:Dnah5 UTSW 15 28302387 missense probably damaging 1.00
P0014:Dnah5 UTSW 15 28403473 missense probably damaging 1.00
PIT4687001:Dnah5 UTSW 15 28383577 missense probably damaging 0.98
R0030:Dnah5 UTSW 15 28451517 missense probably benign 0.34
R0087:Dnah5 UTSW 15 28350613 missense probably damaging 1.00
R0099:Dnah5 UTSW 15 28239934 missense probably damaging 1.00
R0102:Dnah5 UTSW 15 28245751 splice site probably benign
R0102:Dnah5 UTSW 15 28245751 splice site probably benign
R0104:Dnah5 UTSW 15 28453353 missense possibly damaging 0.88
R0112:Dnah5 UTSW 15 28263679 missense probably benign 0.00
R0122:Dnah5 UTSW 15 28378363 missense probably damaging 1.00
R0126:Dnah5 UTSW 15 28246319 missense probably benign 0.00
R0127:Dnah5 UTSW 15 28294925 missense probably damaging 1.00
R0233:Dnah5 UTSW 15 28333070 missense probably damaging 1.00
R0310:Dnah5 UTSW 15 28299110 missense probably benign 0.19
R0386:Dnah5 UTSW 15 28383581 missense probably damaging 1.00
R0421:Dnah5 UTSW 15 28229541 missense possibly damaging 0.79
R0481:Dnah5 UTSW 15 28383599 missense probably benign 0.31
R0609:Dnah5 UTSW 15 28327779 missense probably benign
R0720:Dnah5 UTSW 15 28313861 missense probably null 0.98
R0731:Dnah5 UTSW 15 28311143 missense possibly damaging 0.78
R0747:Dnah5 UTSW 15 28444186 missense probably damaging 0.99
R0747:Dnah5 UTSW 15 28444187 missense possibly damaging 0.64
R0766:Dnah5 UTSW 15 28448487 missense probably null 0.89
R0849:Dnah5 UTSW 15 28263599 missense probably damaging 0.96
R1034:Dnah5 UTSW 15 28302471 missense probably damaging 1.00
R1084:Dnah5 UTSW 15 28343452 missense probably benign 0.01
R1148:Dnah5 UTSW 15 28421690 missense probably damaging 1.00
R1148:Dnah5 UTSW 15 28421690 missense probably damaging 1.00
R1200:Dnah5 UTSW 15 28246257 missense possibly damaging 0.88
R1208:Dnah5 UTSW 15 28327731 missense probably damaging 1.00
R1208:Dnah5 UTSW 15 28327731 missense probably damaging 1.00
R1269:Dnah5 UTSW 15 28238511 missense probably damaging 1.00
R1373:Dnah5 UTSW 15 28313918 splice site probably benign
R1401:Dnah5 UTSW 15 28401913 missense probably damaging 1.00
R1413:Dnah5 UTSW 15 28370409 missense probably benign
R1430:Dnah5 UTSW 15 28345857 missense probably benign 0.37
R1457:Dnah5 UTSW 15 28403542 critical splice donor site probably null
R1468:Dnah5 UTSW 15 28230463 nonsense probably null
R1468:Dnah5 UTSW 15 28230463 nonsense probably null
R1560:Dnah5 UTSW 15 28420003 missense probably damaging 1.00
R1568:Dnah5 UTSW 15 28409177 missense probably damaging 0.98
R1574:Dnah5 UTSW 15 28252423 missense probably benign 0.00
R1574:Dnah5 UTSW 15 28252423 missense probably benign 0.00
R1603:Dnah5 UTSW 15 28294985 splice site probably benign
R1603:Dnah5 UTSW 15 28449180 missense probably benign 0.09
R1673:Dnah5 UTSW 15 28290148 missense probably benign
R1755:Dnah5 UTSW 15 28326636 missense probably damaging 0.99
R1785:Dnah5 UTSW 15 28313786 missense probably damaging 1.00
R1786:Dnah5 UTSW 15 28313786 missense probably damaging 1.00
R1789:Dnah5 UTSW 15 28270426 missense probably benign 0.00
R1817:Dnah5 UTSW 15 28246400 nonsense probably null
R1819:Dnah5 UTSW 15 28246400 nonsense probably null
R1834:Dnah5 UTSW 15 28409124 missense probably benign 0.00
R1855:Dnah5 UTSW 15 28411669 missense possibly damaging 0.88
R1870:Dnah5 UTSW 15 28331713 nonsense probably null
R1871:Dnah5 UTSW 15 28331713 nonsense probably null
R1987:Dnah5 UTSW 15 28343591 missense probably damaging 0.99
R1988:Dnah5 UTSW 15 28343591 missense probably damaging 0.99
R1989:Dnah5 UTSW 15 28343591 missense probably damaging 0.99
R2062:Dnah5 UTSW 15 28366270 missense probably damaging 1.00
R2069:Dnah5 UTSW 15 28312388 splice site probably null
R2121:Dnah5 UTSW 15 28297005 splice site probably benign
R2128:Dnah5 UTSW 15 28408321 missense probably benign 0.00
R2129:Dnah5 UTSW 15 28408321 missense probably benign 0.00
R2151:Dnah5 UTSW 15 28444091 missense probably damaging 1.00
R2159:Dnah5 UTSW 15 28252545 missense probably benign 0.00
R2207:Dnah5 UTSW 15 28343671 missense probably benign 0.11
R2231:Dnah5 UTSW 15 28408417 critical splice donor site probably null
R2232:Dnah5 UTSW 15 28408417 critical splice donor site probably null
R2282:Dnah5 UTSW 15 28327302 missense probably damaging 0.99
R2305:Dnah5 UTSW 15 28387767 missense probably benign 0.25
R2339:Dnah5 UTSW 15 28313882 missense probably benign 0.00
R2437:Dnah5 UTSW 15 28307391 critical splice donor site probably null
R2696:Dnah5 UTSW 15 28278576 missense probably benign 0.00
R3156:Dnah5 UTSW 15 28438091 splice site probably benign
R3431:Dnah5 UTSW 15 28295267 missense probably benign 0.20
R3700:Dnah5 UTSW 15 28387791 missense possibly damaging 0.72
R3724:Dnah5 UTSW 15 28270420 missense probably benign 0.08
R3732:Dnah5 UTSW 15 28409122 missense possibly damaging 0.64
R3872:Dnah5 UTSW 15 28411510 missense possibly damaging 0.50
R4063:Dnah5 UTSW 15 28420998 missense probably damaging 0.98
R4072:Dnah5 UTSW 15 28340298 nonsense probably null
R4075:Dnah5 UTSW 15 28293791 missense probably benign
R4245:Dnah5 UTSW 15 28219189 missense probably benign
R4254:Dnah5 UTSW 15 28438102 missense probably benign 0.07
R4255:Dnah5 UTSW 15 28438102 missense probably benign 0.07
R4392:Dnah5 UTSW 15 28289229 missense probably benign 0.19
R4552:Dnah5 UTSW 15 28397154 missense probably benign 0.19
R4574:Dnah5 UTSW 15 28367763 missense probably benign 0.05
R4577:Dnah5 UTSW 15 28289250 missense probably benign 0.06
R4587:Dnah5 UTSW 15 28304599 missense probably damaging 1.00
R4631:Dnah5 UTSW 15 28401953 missense probably damaging 1.00
R4631:Dnah5 UTSW 15 28419994 missense probably damaging 1.00
R4676:Dnah5 UTSW 15 28295260 missense possibly damaging 0.65
R4707:Dnah5 UTSW 15 28372375 missense probably damaging 0.97
R4754:Dnah5 UTSW 15 28420955 splice site probably null
R4767:Dnah5 UTSW 15 28270474 missense probably benign 0.02
R4857:Dnah5 UTSW 15 28345807 missense probably benign 0.00
R4883:Dnah5 UTSW 15 28343638 missense probably benign 0.00
R4889:Dnah5 UTSW 15 28235792 missense probably benign 0.01
R4946:Dnah5 UTSW 15 28326557 missense probably damaging 0.96
R4946:Dnah5 UTSW 15 28387904 missense probably damaging 1.00
R4947:Dnah5 UTSW 15 28272372 missense probably benign
R5033:Dnah5 UTSW 15 28421678 missense probably damaging 0.96
R5164:Dnah5 UTSW 15 28408292 missense probably benign 0.00
R5175:Dnah5 UTSW 15 28448404 missense probably damaging 1.00
R5182:Dnah5 UTSW 15 28311278 missense probably damaging 0.99
R5187:Dnah5 UTSW 15 28272172 missense probably benign 0.41
R5272:Dnah5 UTSW 15 28350665 missense probably benign
R5308:Dnah5 UTSW 15 28229651 missense possibly damaging 0.80
R5310:Dnah5 UTSW 15 28311328 missense probably damaging 1.00
R5322:Dnah5 UTSW 15 28384244 missense probably benign 0.41
R5398:Dnah5 UTSW 15 28293726 missense probably benign
R5596:Dnah5 UTSW 15 28343608 missense probably damaging 1.00
R5603:Dnah5 UTSW 15 28419932 missense probably damaging 1.00
R5619:Dnah5 UTSW 15 28302435 missense probably damaging 1.00
R5656:Dnah5 UTSW 15 28421064 missense probably benign 0.03
R5741:Dnah5 UTSW 15 28246367 missense probably benign 0.11
R5754:Dnah5 UTSW 15 28401868 missense probably benign 0.01
R5763:Dnah5 UTSW 15 28311152 missense probably damaging 1.00
R5824:Dnah5 UTSW 15 28313821 missense probably benign 0.00
R5836:Dnah5 UTSW 15 28383592 missense probably damaging 1.00
R5838:Dnah5 UTSW 15 28290195 missense probably benign 0.00
R5864:Dnah5 UTSW 15 28297013 missense possibly damaging 0.83
R5895:Dnah5 UTSW 15 28234453 intron probably null
R5896:Dnah5 UTSW 15 28272060 missense probably benign
R5899:Dnah5 UTSW 15 28448367 missense possibly damaging 0.95
R5905:Dnah5 UTSW 15 28387833 missense probably damaging 1.00
R5924:Dnah5 UTSW 15 28307327 missense probably benign 0.41
R5927:Dnah5 UTSW 15 28335718 missense probably benign 0.00
R5929:Dnah5 UTSW 15 28311207 missense probably benign 0.01
R5929:Dnah5 UTSW 15 28311208 missense probably damaging 1.00
R5931:Dnah5 UTSW 15 28453279 missense probably damaging 0.99
R5964:Dnah5 UTSW 15 28458584 missense possibly damaging 0.49
R5975:Dnah5 UTSW 15 28234282 missense probably damaging 1.00
R5993:Dnah5 UTSW 15 28299226 missense probably benign 0.09
R6016:Dnah5 UTSW 15 28327884 missense probably damaging 1.00
R6028:Dnah5 UTSW 15 28387833 missense probably damaging 1.00
R6065:Dnah5 UTSW 15 28230468 missense possibly damaging 0.47
R6117:Dnah5 UTSW 15 28270420 missense probably damaging 0.99
R6143:Dnah5 UTSW 15 28233231 missense probably benign 0.05
R6146:Dnah5 UTSW 15 28459185 missense probably benign
R6154:Dnah5 UTSW 15 28204031 missense probably benign 0.15
R6164:Dnah5 UTSW 15 28378343 missense probably benign 0.08
R6266:Dnah5 UTSW 15 28335627 missense possibly damaging 0.67
R6321:Dnah5 UTSW 15 28372411 missense probably damaging 0.99
R6349:Dnah5 UTSW 15 28238511 missense probably damaging 1.00
R6431:Dnah5 UTSW 15 28349824 missense possibly damaging 0.52
R6467:Dnah5 UTSW 15 28438183 missense probably benign 0.10
R6564:Dnah5 UTSW 15 28367745 missense probably benign
R6607:Dnah5 UTSW 15 28445200 missense possibly damaging 0.95
R6619:Dnah5 UTSW 15 28409120 missense probably benign 0.03
R6633:Dnah5 UTSW 15 28293787 missense probably benign 0.27
R6647:Dnah5 UTSW 15 28403487 missense probably benign 0.02
R6782:Dnah5 UTSW 15 28449156 missense possibly damaging 0.89
R6797:Dnah5 UTSW 15 28233238 nonsense probably null
R6797:Dnah5 UTSW 15 28451463 missense probably damaging 1.00
R6831:Dnah5 UTSW 15 28411515 missense possibly damaging 0.88
R6849:Dnah5 UTSW 15 28278624 missense probably benign 0.14
R6871:Dnah5 UTSW 15 28229640 missense probably benign 0.32
R6936:Dnah5 UTSW 15 28409268 missense probably damaging 1.00
R6943:Dnah5 UTSW 15 28235720 missense probably damaging 1.00
R7030:Dnah5 UTSW 15 28238592 missense probably benign
R7030:Dnah5 UTSW 15 28333062 missense probably benign 0.00
R7032:Dnah5 UTSW 15 28326650 missense probably damaging 1.00
R7063:Dnah5 UTSW 15 28233248 missense probably benign 0.00
R7094:Dnah5 UTSW 15 28453336 missense probably damaging 0.98
R7097:Dnah5 UTSW 15 28453264 missense probably benign 0.00
R7126:Dnah5 UTSW 15 28349837 missense probably benign 0.03
R7209:Dnah5 UTSW 15 28459225 missense possibly damaging 0.71
R7276:Dnah5 UTSW 15 28367838 missense probably damaging 1.00
R7320:Dnah5 UTSW 15 28270470 missense probably null 0.33
X0011:Dnah5 UTSW 15 28408381 missense probably benign 0.16
X0018:Dnah5 UTSW 15 28269354 missense probably benign 0.00
X0022:Dnah5 UTSW 15 28270411 missense probably benign 0.01
X0023:Dnah5 UTSW 15 28384308 missense probably damaging 0.99
X0028:Dnah5 UTSW 15 28470477 missense probably damaging 1.00
Z1088:Dnah5 UTSW 15 28366357 missense probably null 0.10
Z1088:Dnah5 UTSW 15 28384230 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGAACAAAGTGGGTTCTATAACCTGGA -3'
(R):5'- CAATTCTGTTGAGTACCCTGGTGGTTAG -3'

Sequencing Primer
(F):5'- GTTCTATAACCTGGAGAAGCCTG -3'
(R):5'- GGCACCTGTTCTTAACAAAGG -3'
Posted On2013-06-12