Incidental Mutation 'R5982:Dsg4'
ID481504
Institutional Source Beutler Lab
Gene Symbol Dsg4
Ensembl Gene ENSMUSG00000001804
Gene Namedesmoglein 4
Synonymslah, CDHF13
MMRRC Submission 044163-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.562) question?
Stock #R5982 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location20436175-20471821 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 20465169 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 715 (S715T)
Ref Sequence ENSEMBL: ENSMUSP00000019426 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019426]
Predicted Effect possibly damaging
Transcript: ENSMUST00000019426
AA Change: S715T

PolyPhen 2 Score 0.765 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000019426
Gene: ENSMUSG00000001804
AA Change: S715T

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
CA 70 155 1.54e-11 SMART
CA 179 267 4.27e-19 SMART
CA 290 384 5.48e-8 SMART
CA 411 495 9.4e-7 SMART
transmembrane domain 634 656 N/A INTRINSIC
low complexity region 724 736 N/A INTRINSIC
Pfam:Cadherin_C 749 849 3.1e-8 PFAM
Meta Mutation Damage Score 0.262 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.2%
Validation Efficiency 98% (81/83)
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. This gene is expressed in the suprabasal epidermis and hair follicle. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Certain mutations in this gene are responsible for the lanceolate hair phenotype in mice. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice carrying mutations at this locus exhibit abnormalities in hair growth, vibrissae growth, and a thickened epidermis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T A 11: 109,953,597 E931D possibly damaging Het
Aebp1 C T 11: 5,867,911 T62I possibly damaging Het
Babam2 A T 5: 31,820,620 E139V possibly damaging Het
Bclaf1 C T 10: 20,323,063 R67* probably null Het
Bcr C A 10: 75,176,416 T51K probably benign Het
Best3 T A 10: 117,004,417 C251S probably damaging Het
Birc6 A G 17: 74,648,158 M3457V probably benign Het
C87436 C A 6: 86,445,975 T177K possibly damaging Het
Cabin1 T A 10: 75,725,560 T1036S probably benign Het
Catsperg2 C A 7: 29,713,017 V383L possibly damaging Het
Ccdc182 C T 11: 88,294,339 Q82* probably null Het
Ccl9 T C 11: 83,575,874 T76A probably damaging Het
Cdc16 G T 8: 13,781,399 C544F possibly damaging Het
Cdh18 A C 15: 23,474,216 D724A possibly damaging Het
Cdip1 G A 16: 4,770,082 P6S probably damaging Het
Col12a1 A G 9: 79,630,560 V2542A probably damaging Het
Dnajc13 G T 9: 104,184,615 T1380K possibly damaging Het
Dync2h1 G T 9: 6,955,986 T4132K probably benign Het
Egfem1 A T 3: 29,657,270 probably null Het
Etl4 G T 2: 20,781,015 V716L probably damaging Het
Exoc3l2 A G 7: 19,480,032 E461G unknown Het
Fam135b A G 15: 71,448,669 probably null Het
Flrt3 G T 2: 140,660,916 P264Q possibly damaging Het
Fmn2 G C 1: 174,502,453 E136D unknown Het
Fosl2 A G 5: 32,146,873 I51V probably benign Het
Foxm1 A G 6: 128,371,035 T307A probably damaging Het
Garem1 T C 18: 21,148,351 D316G possibly damaging Het
Gm13088 C A 4: 143,654,464 V330F probably damaging Het
Gm14403 A T 2: 177,508,552 H97L probably damaging Het
Gm5616 A G 9: 48,450,590 noncoding transcript Het
Hkdc1 T C 10: 62,393,810 D696G probably benign Het
Igkv1-88 C A 6: 68,862,448 W60L probably damaging Het
Iqgap3 G A 3: 88,091,592 W333* probably null Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kcnk3 G T 5: 30,622,670 V355L probably benign Het
Kmt5c A C 7: 4,746,791 K436T probably damaging Het
Lynx1 T C 15: 74,751,415 Y56C possibly damaging Het
Lypd5 T C 7: 24,353,037 S149P probably damaging Het
Map3k21 A T 8: 125,911,430 N252Y probably damaging Het
Mgat2 T C 12: 69,185,680 W343R probably damaging Het
Misp T G 10: 79,827,894 Y567* probably null Het
Mrgprb1 A T 7: 48,447,820 S115T probably benign Het
Muc16 A C 9: 18,647,146 I2617R unknown Het
Myo19 T A 11: 84,899,400 V394E probably damaging Het
Myo9b T A 8: 71,348,396 L1065Q probably benign Het
Nap1l1 A G 10: 111,495,368 D405G possibly damaging Het
Napb A T 2: 148,700,491 probably null Het
Nbas A G 12: 13,393,430 Y1162C probably benign Het
Nfam1 A T 15: 83,033,124 L36Q probably damaging Het
Nrros T C 16: 32,144,593 D202G probably damaging Het
Olfr1355 T G 10: 78,879,953 Y260* probably null Het
Olfr639 T G 7: 104,011,910 H264P probably damaging Het
Osgin2 T C 4: 15,998,908 E238G probably benign Het
Papss2 A G 19: 32,639,236 T221A probably benign Het
Pcdhga12 A C 18: 37,768,031 K639Q probably damaging Het
Pkhd1l1 T A 15: 44,489,504 probably null Het
Pmepa1 A G 2: 173,234,312 S83P possibly damaging Het
Pnp G A 14: 50,950,543 V118M probably damaging Het
Ppat T C 5: 76,915,265 T500A probably benign Het
Rab11fip4 A G 11: 79,690,775 N532S probably benign Het
Rbm25 A G 12: 83,671,951 D499G probably damaging Het
Rnf139 A G 15: 58,898,838 I237M possibly damaging Het
Rrp15 C T 1: 186,739,755 S85N possibly damaging Het
Sidt1 T C 16: 44,261,708 Y568C probably damaging Het
Slirp A G 12: 87,444,014 T29A probably damaging Het
Sltm G C 9: 70,586,804 E828Q probably damaging Het
Spindoc A G 19: 7,374,595 I129T probably damaging Het
Spire1 T A 18: 67,497,316 probably null Het
Styx A G 14: 45,368,452 T138A probably benign Het
Sv2c A T 13: 95,976,063 L642* probably null Het
Taf7 T C 18: 37,643,445 E23G probably damaging Het
Tcp10a A T 17: 7,345,026 T406S possibly damaging Het
Tnrc6b T A 15: 80,880,816 S840T probably benign Het
Tns3 A G 11: 8,492,245 I706T probably damaging Het
Tpsab1 A G 17: 25,345,372 V36A probably benign Het
Trafd1 T A 5: 121,373,279 D492V probably damaging Het
Trp53 A G 11: 69,587,418 E51G probably benign Het
Vdr C T 15: 97,857,596 A349T probably benign Het
Vmn2r59 T C 7: 42,046,067 D307G probably benign Het
Zfp365 C A 10: 67,897,607 V252F probably damaging Het
Zfp830 T A 11: 82,764,977 N202K probably benign Het
Other mutations in Dsg4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00708:Dsg4 APN 18 20461326 missense probably benign 0.22
IGL01723:Dsg4 APN 18 20466510 missense probably damaging 1.00
IGL02249:Dsg4 APN 18 20461304 missense possibly damaging 0.69
IGL02445:Dsg4 APN 18 20446250 splice site probably benign
IGL02553:Dsg4 APN 18 20462520 missense probably benign
IGL02578:Dsg4 APN 18 20471193 missense possibly damaging 0.94
IGL02634:Dsg4 APN 18 20458580 missense probably benign 0.01
IGL02677:Dsg4 APN 18 20464876 missense possibly damaging 0.62
IGL02741:Dsg4 APN 18 20471496 missense probably benign
IGL02747:Dsg4 APN 18 20446938 missense probably damaging 0.97
IGL03342:Dsg4 APN 18 20451823 missense probably damaging 1.00
burrito UTSW 18 20451862 missense possibly damaging 0.81
R0043:Dsg4 UTSW 18 20452972 missense probably damaging 1.00
R0375:Dsg4 UTSW 18 20470879 missense probably damaging 1.00
R0537:Dsg4 UTSW 18 20458571 missense probably damaging 1.00
R0619:Dsg4 UTSW 18 20461359 missense probably benign 0.00
R0622:Dsg4 UTSW 18 20449788 missense possibly damaging 0.51
R0765:Dsg4 UTSW 18 20454646 splice site probably benign
R0786:Dsg4 UTSW 18 20449372 critical splice donor site probably null
R1114:Dsg4 UTSW 18 20466483 missense possibly damaging 0.62
R1249:Dsg4 UTSW 18 20446872 nonsense probably null
R1372:Dsg4 UTSW 18 20449676 splice site probably null
R1382:Dsg4 UTSW 18 20465124 missense probably benign 0.00
R1392:Dsg4 UTSW 18 20446247 splice site probably benign
R1442:Dsg4 UTSW 18 20462660 missense possibly damaging 0.76
R1503:Dsg4 UTSW 18 20449679 missense probably damaging 1.00
R1704:Dsg4 UTSW 18 20471589 missense probably damaging 1.00
R1716:Dsg4 UTSW 18 20462461 nonsense probably null
R1765:Dsg4 UTSW 18 20456831 missense probably benign 0.01
R1817:Dsg4 UTSW 18 20471245 missense probably damaging 1.00
R1982:Dsg4 UTSW 18 20471212 missense probably damaging 1.00
R2025:Dsg4 UTSW 18 20466636 nonsense probably null
R2097:Dsg4 UTSW 18 20471044 missense probably damaging 1.00
R2198:Dsg4 UTSW 18 20461442 missense probably benign
R3551:Dsg4 UTSW 18 20451756 missense probably damaging 1.00
R3742:Dsg4 UTSW 18 20471001 missense probably damaging 1.00
R3853:Dsg4 UTSW 18 20449234 missense probably benign
R3955:Dsg4 UTSW 18 20449375 splice site probably null
R4006:Dsg4 UTSW 18 20470965 missense probably damaging 0.97
R4012:Dsg4 UTSW 18 20451862 missense possibly damaging 0.81
R4171:Dsg4 UTSW 18 20458579 nonsense probably null
R4254:Dsg4 UTSW 18 20471538 missense probably benign 0.07
R4504:Dsg4 UTSW 18 20461436 missense probably benign 0.00
R4559:Dsg4 UTSW 18 20470921 missense probably damaging 1.00
R4607:Dsg4 UTSW 18 20471245 missense probably damaging 1.00
R4612:Dsg4 UTSW 18 20462413 missense probably benign 0.10
R4683:Dsg4 UTSW 18 20461409 missense probably benign
R4700:Dsg4 UTSW 18 20456908 missense possibly damaging 0.91
R4749:Dsg4 UTSW 18 20446831 missense possibly damaging 0.88
R4775:Dsg4 UTSW 18 20471127 missense possibly damaging 0.48
R4809:Dsg4 UTSW 18 20466621 missense possibly damaging 0.82
R5276:Dsg4 UTSW 18 20446839 missense probably benign 0.21
R5426:Dsg4 UTSW 18 20458484 missense probably damaging 1.00
R5767:Dsg4 UTSW 18 20462492 nonsense probably null
R6280:Dsg4 UTSW 18 20466667 missense probably damaging 1.00
R6305:Dsg4 UTSW 18 20449790 missense probably damaging 1.00
R6489:Dsg4 UTSW 18 20471363 missense possibly damaging 0.93
R7013:Dsg4 UTSW 18 20458521 missense possibly damaging 0.58
R7040:Dsg4 UTSW 18 20451852 missense probably benign 0.01
R7196:Dsg4 UTSW 18 20466480 missense probably damaging 1.00
R7432:Dsg4 UTSW 18 20446266 nonsense probably null
R7438:Dsg4 UTSW 18 20466628 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TTTCTATGGGAGCTCAGCCG -3'
(R):5'- CCCAGTTATGGTTTCAGAATGTGC -3'

Sequencing Primer
(F):5'- GGCCTTGACAATTCCATGCAG -3'
(R):5'- GGTTTCAGAATGTGCCTGTTAAATC -3'
Posted On2017-06-26