Incidental Mutation 'R5983:Abhd18'
ID481514
Institutional Source Beutler Lab
Gene Symbol Abhd18
Ensembl Gene ENSMUSG00000037818
Gene Nameabhydrolase domain containing 18
Synonyms3110057O12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R5983 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location40846970-40938138 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 40910544 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 73 (F73L)
Ref Sequence ENSEMBL: ENSMUSP00000124430 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108077] [ENSMUST00000108078] [ENSMUST00000159774] [ENSMUST00000203214] [ENSMUST00000203472] [ENSMUST00000203650] [ENSMUST00000203892] [ENSMUST00000204496] [ENSMUST00000205065]
Predicted Effect probably damaging
Transcript: ENSMUST00000108077
AA Change: F73L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103712
Gene: ENSMUSG00000037818
AA Change: F73L

DomainStartEndE-ValueType
Pfam:DUF2048 16 457 7.7e-168 PFAM
Pfam:Abhydrolase_6 91 445 1.4e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108078
AA Change: F73L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103713
Gene: ENSMUSG00000037818
AA Change: F73L

DomainStartEndE-ValueType
Pfam:DUF2048 16 457 7.7e-168 PFAM
Pfam:Abhydrolase_6 91 445 1.4e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000159774
AA Change: F73L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124430
Gene: ENSMUSG00000037818
AA Change: F73L

DomainStartEndE-ValueType
Pfam:DUF2048 16 457 1.3e-171 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203214
SMART Domains Protein: ENSMUSP00000144946
Gene: ENSMUSG00000037818

DomainStartEndE-ValueType
Pfam:DUF2048 16 62 1.7e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203472
SMART Domains Protein: ENSMUSP00000145313
Gene: ENSMUSG00000037818

DomainStartEndE-ValueType
Pfam:DUF2048 1 75 1.1e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203650
SMART Domains Protein: ENSMUSP00000145006
Gene: ENSMUSG00000037818

DomainStartEndE-ValueType
Pfam:DUF2048 1 130 8.8e-71 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000203892
AA Change: F73L

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000145150
Gene: ENSMUSG00000037818
AA Change: F73L

DomainStartEndE-ValueType
Pfam:DUF2048 16 151 7.8e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204496
SMART Domains Protein: ENSMUSP00000145007
Gene: ENSMUSG00000037818

DomainStartEndE-ValueType
Pfam:DUF2048 16 67 2.2e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204797
Predicted Effect probably damaging
Transcript: ENSMUST00000205065
AA Change: F73L

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000145095
Gene: ENSMUSG00000037818
AA Change: F73L

DomainStartEndE-ValueType
Pfam:DUF2048 16 151 7.8e-65 PFAM
Meta Mutation Damage Score 0.542 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency 100% (29/29)
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 T A 19: 43,819,503 M861K probably benign Het
Abraxas1 A G 5: 100,807,911 V237A probably benign Het
Adam26b T C 8: 43,521,341 Y208C probably damaging Het
Aire A G 10: 78,043,069 L48P probably damaging Het
AU019823 A G 9: 50,607,842 S157P probably damaging Het
Bach2 A T 4: 32,563,324 E597V probably damaging Het
Ccdc170 A T 10: 4,520,851 R232* probably null Het
Cfap100 A C 6: 90,419,391 probably benign Het
D430042O09Rik T A 7: 125,850,373 W870R probably damaging Het
Dppa2 G A 16: 48,315,841 M185I probably benign Het
Ecsit C T 9: 22,078,147 probably null Het
Fbxw26 A G 9: 109,717,965 I464T possibly damaging Het
Grm8 T C 6: 27,760,221 K370R probably benign Het
Ide C T 19: 37,272,150 probably null Het
Morn3 T C 5: 123,037,788 D179G possibly damaging Het
Nvl A T 1: 181,136,906 D102E probably benign Het
Olfr1436 T A 19: 12,299,103 I10F probably benign Het
Rbm5 G A 9: 107,744,942 P611L probably damaging Het
Rsph9 A G 17: 46,129,480 M230T probably benign Het
Sacs G A 14: 61,205,199 V1565M probably damaging Het
Serpina3n T C 12: 104,409,029 L120P probably damaging Het
Spsb2 A C 6: 124,809,748 E148A probably benign Het
Tmc2 T A 2: 130,247,976 M627K probably damaging Het
Tmem147 T C 7: 30,728,059 D111G probably damaging Het
Ttn A G 2: 76,742,381 V17729A possibly damaging Het
Vmn2r104 G A 17: 20,041,708 P387S probably damaging Het
Zfp940 C T 7: 29,845,052 V477M possibly damaging Het
Zw10 A G 9: 49,077,445 probably null Het
Other mutations in Abhd18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01319:Abhd18 APN 3 40933642 missense probably benign 0.00
IGL01785:Abhd18 APN 3 40905904 missense probably damaging 1.00
IGL02318:Abhd18 APN 3 40930227 critical splice donor site probably null
IGL02447:Abhd18 APN 3 40933773 missense probably benign
IGL02823:Abhd18 APN 3 40933518 splice site probably benign
IGL03023:Abhd18 APN 3 40904984 missense probably damaging 0.98
F2404:Abhd18 UTSW 3 40933878 missense probably damaging 0.99
R0064:Abhd18 UTSW 3 40933853 missense probably benign 0.00
R0064:Abhd18 UTSW 3 40933853 missense probably benign 0.00
R0494:Abhd18 UTSW 3 40916688 missense probably damaging 1.00
R1994:Abhd18 UTSW 3 40934926 nonsense probably null
R2206:Abhd18 UTSW 3 40910573 missense probably benign 0.00
R2223:Abhd18 UTSW 3 40934861 splice site probably benign
R2698:Abhd18 UTSW 3 40930966 missense probably benign 0.03
R3406:Abhd18 UTSW 3 40904903 start codon destroyed probably null 1.00
R3747:Abhd18 UTSW 3 40933573 missense probably benign
R4899:Abhd18 UTSW 3 40905869 splice site probably null
R5259:Abhd18 UTSW 3 40916890 missense probably damaging 1.00
R5673:Abhd18 UTSW 3 40923451 missense probably damaging 1.00
R5713:Abhd18 UTSW 3 40934979 nonsense probably null
R5797:Abhd18 UTSW 3 40933551 missense probably benign 0.08
R6333:Abhd18 UTSW 3 40933783 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCTCATGTGCAAGAACTAAGAG -3'
(R):5'- TGGTGTTGACTTCTTAAGCTTTCAC -3'

Sequencing Primer
(F):5'- TGCAAGAACTAAGAGAATGTTAGTG -3'
(R):5'- TGCATGGAGGGCAATTAATCTCC -3'
Posted On2017-06-26