Mutagenetix > Incidental Mutation

Incidental Mutation 'R5985:Speg'

481582

Institutional Source

Beutler Lab

Gene Symbol

Speg

Ensembl Gene

ENSMUSG00000026207

Gene Name

SPEG complex locus

Synonyms

SPEG, SPEGalpha, SPEGbeta, Apeg1, BPEG, D1Bwg1450e

MMRRC Submission

044165-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5985 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

75351941-75408964 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 75383328 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 1141 (V1141A)

Ref Sequence

ENSEMBL: ENSMUSP00000084361 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000087122] [ENSMUST00000113587] [ENSMUST00000113588] [ENSMUST00000113589] [ENSMUST00000113590] [ENSMUST00000122266]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000087122
AA Change: V1141A

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000084361
Gene: ENSMUSG00000026207
AA Change: V1141A

Domain	Start	End	E-Value	Type
IG	51	128	1.48e-6	SMART
low complexity region	292	318	N/A	INTRINSIC
low complexity region	325	338	N/A	INTRINSIC
low complexity region	359	368	N/A	INTRINSIC
low complexity region	412	423	N/A	INTRINSIC
low complexity region	573	584	N/A	INTRINSIC
IGc2	739	806	2.19e-9	SMART
Pfam:SPEG_u2	817	873	2.4e-36	PFAM
IGc2	886	954	4.03e-8	SMART
IG	979	1064	1.05e-6	SMART
IGc2	1081	1148	2.19e-9	SMART
IG	1199	1283	6.87e-2	SMART
FN3	1287	1373	1.38e-4	SMART
IG	1401	1487	2.64e-3	SMART
IGc2	1502	1569	1.12e-6	SMART
STYKc	1606	1859	8.44e-63	SMART
Blast:STYKc	1861	1895	6e-12	BLAST
low complexity region	1918	1939	N/A	INTRINSIC
low complexity region	2069	2081	N/A	INTRINSIC
low complexity region	2208	2227	N/A	INTRINSIC
low complexity region	2230	2249	N/A	INTRINSIC
low complexity region	2255	2269	N/A	INTRINSIC
low complexity region	2343	2366	N/A	INTRINSIC
low complexity region	2410	2422	N/A	INTRINSIC
low complexity region	2433	2451	N/A	INTRINSIC
low complexity region	2457	2487	N/A	INTRINSIC
low complexity region	2524	2544	N/A	INTRINSIC
IGc2	2599	2667	2.05e-9	SMART
FN3	2681	2760	2.5e-2	SMART
low complexity region	2775	2789	N/A	INTRINSIC
low complexity region	2802	2831	N/A	INTRINSIC
low complexity region	2912	2927	N/A	INTRINSIC
STYKc	2961	3213	4.42e-66	SMART
low complexity region	3241	3250	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000113587

SMART Domains

Protein: ENSMUSP00000109217
Gene: ENSMUSG00000026207

Domain	Start	End	E-Value	Type
low complexity region	4	16	N/A	INTRINSIC
IGc2	32	100	4.03e-8	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000113588

SMART Domains

Protein: ENSMUSP00000109218
Gene: ENSMUSG00000026207

Domain	Start	End	E-Value	Type
low complexity region	4	16	N/A	INTRINSIC
IGc2	32	100	4.03e-8	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000113589

SMART Domains

Protein: ENSMUSP00000109219
Gene: ENSMUSG00000026207

Domain	Start	End	E-Value	Type
low complexity region	4	16	N/A	INTRINSIC
IGc2	32	100	4.03e-8	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000113590

SMART Domains

Protein: ENSMUSP00000109220
Gene: ENSMUSG00000026207

Domain	Start	End	E-Value	Type
low complexity region	186	212	N/A	INTRINSIC
low complexity region	219	232	N/A	INTRINSIC
low complexity region	253	262	N/A	INTRINSIC
low complexity region	306	317	N/A	INTRINSIC
low complexity region	467	478	N/A	INTRINSIC
IGc2	633	700	2.19e-9	SMART
low complexity region	752	764	N/A	INTRINSIC
IGc2	780	848	4.03e-8	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000122266

SMART Domains

Protein: ENSMUSP00000113646
Gene: ENSMUSG00000026207

Domain	Start	End	E-Value	Type
low complexity region	4	16	N/A	INTRINSIC
IGc2	32	100	4.03e-8	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000137868
AA Change: V888A

Meta Mutation Damage Score

0.1904

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.7%
20x: 93.2%

Validation Efficiency

96% (47/49)

MGI Phenotype

FUNCTION: This gene encodes a protein with similarity to members of the myosin light chain kinase family. This protein family is required for myocyte cytoskeletal development. Studies have determined that a lack of this protein affected myocardial development. Multiple alternatively spliced transcript variants that encode different protein isoforms have been defined. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele die during the early postnatal period with enlarged, dilated hearts, and decreased cardiac function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	A	C	11: 9,241,628 (GRCm39)	I1164L	probably benign	Het
Actn1	C	A	12: 80,215,169 (GRCm39)	G864V	probably damaging	Het
Adgrf1	T	C	17: 43,604,146 (GRCm39)	I34T	probably benign	Het
Ankrd10	T	A	8: 11,669,077 (GRCm39)	K225*	probably null	Het
Ankrd29	G	A	18: 12,412,832 (GRCm39)	A115V	probably damaging	Het
Armh3	A	T	19: 45,808,763 (GRCm39)	Y643N	probably damaging	Het
Atg2a	A	G	19: 6,304,667 (GRCm39)	T1175A	probably damaging	Het
Atp12a	A	G	14: 56,621,798 (GRCm39)	D781G	probably damaging	Het
B4galnt3	G	A	6: 120,187,119 (GRCm39)	P759S	probably damaging	Het
Card10	T	C	15: 78,675,411 (GRCm39)	I448V	probably benign	Het
Col15a1	T	C	4: 47,284,507 (GRCm39)	F821L	probably damaging	Het
Cpeb3	T	C	19: 37,064,952 (GRCm39)	Y498C	probably damaging	Het
Defb37	A	T	8: 19,036,347 (GRCm39)	C58S	probably damaging	Het
Faap20	T	C	4: 155,334,797 (GRCm39)		probably benign	Het
Frem1	C	T	4: 82,884,287 (GRCm39)	V1204I	probably benign	Het
Gal3st2	T	C	1: 93,801,335 (GRCm39)	V46A	possibly damaging	Het
Gan	C	T	8: 117,922,557 (GRCm39)	S430L	possibly damaging	Het
Gas2	T	A	7: 51,593,424 (GRCm39)	I168K	probably damaging	Het
Gli3	A	G	13: 15,898,140 (GRCm39)	D740G	probably damaging	Het
Gm3898	G	A	9: 43,741,329 (GRCm39)		noncoding transcript	Het
Gria4	T	C	9: 4,503,593 (GRCm39)	Q341R	probably damaging	Het
Herpud1	G	A	8: 95,117,422 (GRCm39)	R2Q	probably damaging	Het
Klf15	G	A	6: 90,443,703 (GRCm39)	G93R	possibly damaging	Het
Mtmr7	A	G	8: 41,004,873 (GRCm39)	F568L	probably benign	Het
Myod1	A	G	7: 46,027,222 (GRCm39)	Y229C	probably damaging	Het
Or12e14	A	G	2: 87,187,949 (GRCm39)	I54V	probably benign	Het
Or5l13	A	G	2: 87,779,665 (GRCm39)	M304T	probably benign	Het
Phf11b	A	G	14: 59,559,027 (GRCm39)	L235P	possibly damaging	Het
Pira1	C	A	7: 3,740,316 (GRCm39)	G302C	probably damaging	Het
Plekha6	G	C	1: 133,200,045 (GRCm39)	R208P	possibly damaging	Het
Prox1	A	T	1: 189,879,152 (GRCm39)	F675L	possibly damaging	Het
Rnf144a	C	T	12: 26,367,779 (GRCm39)	E176K	probably benign	Het
Safb2	T	C	17: 56,870,181 (GRCm39)	E965G	possibly damaging	Het
Sik3	A	G	9: 46,122,973 (GRCm39)	N874S	probably damaging	Het
Slitrk3	T	C	3: 72,958,233 (GRCm39)	I180V	probably damaging	Het
Spns1	G	A	7: 125,975,902 (GRCm39)	T84I	probably benign	Het
Syne2	C	G	12: 76,012,933 (GRCm39)	P2709R	probably damaging	Het
Terb1	A	T	8: 105,178,439 (GRCm39)	S662T	probably benign	Het
Terb1	A	G	8: 105,208,948 (GRCm39)	S377P	probably damaging	Het
Tph1	A	G	7: 46,303,205 (GRCm39)	Y258H	probably damaging	Het
Trip12	T	A	1: 84,703,492 (GRCm39)	E1881D	probably damaging	Het
Trpc7	A	G	13: 56,958,358 (GRCm39)	L412P	probably damaging	Het
Ttll13	C	T	7: 79,904,386 (GRCm39)	A337V	probably damaging	Het
Ugt2b1	T	C	5: 87,067,527 (GRCm39)	K344E	possibly damaging	Het
Vmn1r36	T	A	6: 66,693,855 (GRCm39)	I7F	probably benign	Het
Vmn2r14	A	T	5: 109,368,082 (GRCm39)	N303K	possibly damaging	Het
Vmn2r25	A	G	6: 123,800,587 (GRCm39)	V585A	probably benign	Het
Zan	A	C	5: 137,444,299 (GRCm39)		probably null	Het
Zfp423	A	T	8: 88,508,774 (GRCm39)	N502K	possibly damaging	Het
Zfp473	C	T	7: 44,382,752 (GRCm39)	R526Q	probably damaging	Het

Other mutations in Speg

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00838:Speg	APN	1	75,387,034 (GRCm39)	missense	possibly damaging	0.95
IGL00979:Speg	APN	1	75,387,378 (GRCm39)	missense	probably damaging	0.98
IGL01122:Speg	APN	1	75,386,679 (GRCm39)	missense	probably damaging	1.00
IGL01293:Speg	APN	1	75,364,746 (GRCm39)	missense	probably damaging	1.00
IGL01304:Speg	APN	1	75,404,841 (GRCm39)	missense	probably benign	0.00
IGL01351:Speg	APN	1	75,387,920 (GRCm39)	splice site	probably benign
IGL01473:Speg	APN	1	75,404,929 (GRCm39)	missense	possibly damaging	0.53
IGL01477:Speg	APN	1	75,368,541 (GRCm39)	missense	probably damaging	1.00
IGL01485:Speg	APN	1	75,364,471 (GRCm39)	missense	probably damaging	1.00
IGL01584:Speg	APN	1	75,407,581 (GRCm39)	missense	probably damaging	1.00
IGL01959:Speg	APN	1	75,367,734 (GRCm39)	missense	probably damaging	1.00
IGL02231:Speg	APN	1	75,400,031 (GRCm39)	missense	probably damaging	1.00
IGL02355:Speg	APN	1	75,400,559 (GRCm39)	missense	possibly damaging	0.49
IGL02362:Speg	APN	1	75,400,559 (GRCm39)	missense	possibly damaging	0.49
IGL03013:Speg	APN	1	75,407,923 (GRCm39)	missense	probably damaging	0.97
IGL03168:Speg	APN	1	75,364,831 (GRCm39)	missense	probably damaging	1.00
H8562:Speg	UTSW	1	75,392,241 (GRCm39)	missense	probably benign	0.39
R0112:Speg	UTSW	1	75,361,676 (GRCm39)	missense	possibly damaging	0.92
R0311:Speg	UTSW	1	75,407,581 (GRCm39)	missense	probably damaging	1.00
R0315:Speg	UTSW	1	75,391,780 (GRCm39)	missense	possibly damaging	0.88
R0393:Speg	UTSW	1	75,400,568 (GRCm39)	missense	possibly damaging	0.46
R0403:Speg	UTSW	1	75,407,428 (GRCm39)	splice site	probably benign
R0483:Speg	UTSW	1	75,361,676 (GRCm39)	missense	possibly damaging	0.92
R0648:Speg	UTSW	1	75,404,622 (GRCm39)	missense	probably benign
R0683:Speg	UTSW	1	75,405,762 (GRCm39)	missense	probably damaging	1.00
R0800:Speg	UTSW	1	75,400,133 (GRCm39)	missense	probably damaging	1.00
R0815:Speg	UTSW	1	75,392,036 (GRCm39)	missense	probably damaging	1.00
R0835:Speg	UTSW	1	75,352,318 (GRCm39)	missense	probably benign	0.00
R0866:Speg	UTSW	1	75,393,727 (GRCm39)	missense	probably damaging	0.99
R0880:Speg	UTSW	1	75,381,705 (GRCm39)	missense	probably damaging	1.00
R1082:Speg	UTSW	1	75,391,782 (GRCm39)	missense	possibly damaging	0.94
R1140:Speg	UTSW	1	75,405,739 (GRCm39)	missense	probably damaging	1.00
R1252:Speg	UTSW	1	75,403,739 (GRCm39)	missense	probably damaging	1.00
R1301:Speg	UTSW	1	75,378,145 (GRCm39)	missense	probably damaging	1.00
R1348:Speg	UTSW	1	75,399,516 (GRCm39)	missense	probably damaging	0.99
R1388:Speg	UTSW	1	75,407,104 (GRCm39)	missense	probably damaging	0.99
R1465:Speg	UTSW	1	75,405,128 (GRCm39)	splice site	probably benign
R1505:Speg	UTSW	1	75,352,186 (GRCm39)	missense	probably benign	0.02
R1506:Speg	UTSW	1	75,394,307 (GRCm39)	missense	probably benign	0.03
R1531:Speg	UTSW	1	75,377,866 (GRCm39)	missense	possibly damaging	0.86
R1543:Speg	UTSW	1	75,398,595 (GRCm39)	missense	probably damaging	1.00
R1567:Speg	UTSW	1	75,404,691 (GRCm39)	missense	probably benign
R1630:Speg	UTSW	1	75,399,621 (GRCm39)	missense	probably damaging	1.00
R1667:Speg	UTSW	1	75,387,193 (GRCm39)	splice site	probably benign
R1673:Speg	UTSW	1	75,387,807 (GRCm39)	missense	possibly damaging	0.60
R1718:Speg	UTSW	1	75,398,388 (GRCm39)	missense	possibly damaging	0.87
R1718:Speg	UTSW	1	75,394,507 (GRCm39)	missense	probably benign	0.00
R1719:Speg	UTSW	1	75,394,507 (GRCm39)	missense	probably benign	0.00
R1759:Speg	UTSW	1	75,377,806 (GRCm39)	missense	possibly damaging	0.95
R1861:Speg	UTSW	1	75,365,649 (GRCm39)	missense	probably damaging	1.00
R1874:Speg	UTSW	1	75,400,550 (GRCm39)	missense	probably benign
R1936:Speg	UTSW	1	75,408,052 (GRCm39)	missense	possibly damaging	0.93
R2192:Speg	UTSW	1	75,394,371 (GRCm39)	missense	probably damaging	1.00
R2204:Speg	UTSW	1	75,407,121 (GRCm39)	missense	probably benign	0.30
R2287:Speg	UTSW	1	75,407,109 (GRCm39)	missense	possibly damaging	0.76
R2696:Speg	UTSW	1	75,383,570 (GRCm39)	missense	probably benign	0.27
R2983:Speg	UTSW	1	75,361,574 (GRCm39)	missense	possibly damaging	0.83
R3110:Speg	UTSW	1	75,399,326 (GRCm39)	nonsense	probably null
R3112:Speg	UTSW	1	75,399,326 (GRCm39)	nonsense	probably null
R3154:Speg	UTSW	1	75,378,186 (GRCm39)	missense	probably damaging	1.00
R3720:Speg	UTSW	1	75,403,426 (GRCm39)	missense	probably damaging	1.00
R3983:Speg	UTSW	1	75,399,191 (GRCm39)	missense	probably benign	0.27
R4133:Speg	UTSW	1	75,404,548 (GRCm39)	missense	probably benign
R4522:Speg	UTSW	1	75,404,974 (GRCm39)	missense	probably damaging	1.00
R4564:Speg	UTSW	1	75,368,478 (GRCm39)	missense	probably damaging	1.00
R4577:Speg	UTSW	1	75,392,039 (GRCm39)	missense	probably damaging	1.00
R4858:Speg	UTSW	1	75,398,379 (GRCm39)	missense	probably damaging	1.00
R4953:Speg	UTSW	1	75,400,508 (GRCm39)	missense	possibly damaging	0.72
R4965:Speg	UTSW	1	75,404,347 (GRCm39)	missense	probably damaging	1.00
R4967:Speg	UTSW	1	75,364,513 (GRCm39)	missense	probably damaging	1.00
R5152:Speg	UTSW	1	75,404,742 (GRCm39)	missense	possibly damaging	0.92
R5156:Speg	UTSW	1	75,404,731 (GRCm39)	missense	probably damaging	0.99
R5371:Speg	UTSW	1	75,408,037 (GRCm39)	missense	possibly damaging	0.50
R5550:Speg	UTSW	1	75,405,744 (GRCm39)	missense	probably damaging	1.00
R5562:Speg	UTSW	1	75,403,700 (GRCm39)	missense	probably damaging	1.00
R5687:Speg	UTSW	1	75,395,773 (GRCm39)	splice site	probably null
R6004:Speg	UTSW	1	75,392,247 (GRCm39)	nonsense	probably null
R6038:Speg	UTSW	1	75,395,103 (GRCm39)	critical splice donor site	probably null
R6038:Speg	UTSW	1	75,395,103 (GRCm39)	critical splice donor site	probably null
R6143:Speg	UTSW	1	75,391,031 (GRCm39)	missense	probably damaging	1.00
R6265:Speg	UTSW	1	75,383,323 (GRCm39)	nonsense	probably null
R6347:Speg	UTSW	1	75,403,519 (GRCm39)	missense	probably benign	0.00
R6453:Speg	UTSW	1	75,394,616 (GRCm39)	missense	probably benign	0.06
R6505:Speg	UTSW	1	75,406,167 (GRCm39)	missense	possibly damaging	0.93
R6505:Speg	UTSW	1	75,383,328 (GRCm39)	missense	possibly damaging	0.94
R6531:Speg	UTSW	1	75,399,401 (GRCm39)	missense	probably benign	0.03
R6566:Speg	UTSW	1	75,365,107 (GRCm39)	missense	probably damaging	1.00
R6747:Speg	UTSW	1	75,387,039 (GRCm39)	critical splice donor site	probably null
R6819:Speg	UTSW	1	75,368,456 (GRCm39)	missense	possibly damaging	0.56
R6821:Speg	UTSW	1	75,394,547 (GRCm39)	missense	possibly damaging	0.83
R6919:Speg	UTSW	1	75,364,552 (GRCm39)	nonsense	probably null
R6981:Speg	UTSW	1	75,407,557 (GRCm39)	missense	probably damaging	1.00
R7002:Speg	UTSW	1	75,399,912 (GRCm39)	missense	probably damaging	0.98
R7082:Speg	UTSW	1	75,388,091 (GRCm39)	missense	probably damaging	0.96
R7140:Speg	UTSW	1	75,383,414 (GRCm39)	critical splice donor site	probably null
R7175:Speg	UTSW	1	75,399,134 (GRCm39)	missense	probably benign	0.01
R7178:Speg	UTSW	1	75,399,027 (GRCm39)	missense	possibly damaging	0.46
R7345:Speg	UTSW	1	75,361,479 (GRCm39)	missense	probably damaging	0.97
R7420:Speg	UTSW	1	75,407,549 (GRCm39)	missense	probably damaging	1.00
R7537:Speg	UTSW	1	75,378,108 (GRCm39)	missense	probably damaging	1.00
R7562:Speg	UTSW	1	75,407,923 (GRCm39)	missense	probably damaging	0.97
R7615:Speg	UTSW	1	75,405,886 (GRCm39)	missense	probably damaging	1.00
R7679:Speg	UTSW	1	75,382,959 (GRCm39)	missense	probably damaging	1.00
R7692:Speg	UTSW	1	75,377,834 (GRCm39)	missense	probably benign	0.04
R7696:Speg	UTSW	1	75,405,805 (GRCm39)	missense	probably damaging	1.00
R7719:Speg	UTSW	1	75,352,469 (GRCm39)	missense	probably damaging	1.00
R7794:Speg	UTSW	1	75,365,514 (GRCm39)	missense	probably benign	0.00
R7824:Speg	UTSW	1	75,360,661 (GRCm39)	splice site	probably null
R7834:Speg	UTSW	1	75,361,571 (GRCm39)	missense	probably damaging	1.00
R7892:Speg	UTSW	1	75,403,810 (GRCm39)	missense	probably damaging	1.00
R8015:Speg	UTSW	1	75,392,065 (GRCm39)	splice site	probably benign
R8068:Speg	UTSW	1	75,398,894 (GRCm39)	missense	probably damaging	1.00
R8085:Speg	UTSW	1	75,391,997 (GRCm39)	missense	probably damaging	1.00
R8130:Speg	UTSW	1	75,392,240 (GRCm39)	missense	probably damaging	1.00
R8132:Speg	UTSW	1	75,399,639 (GRCm39)	missense	probably damaging	1.00
R8239:Speg	UTSW	1	75,395,677 (GRCm39)	missense	probably damaging	1.00
R8287:Speg	UTSW	1	75,398,880 (GRCm39)	missense	probably benign	0.26
R8299:Speg	UTSW	1	75,364,480 (GRCm39)	missense	possibly damaging	0.95
R8441:Speg	UTSW	1	75,387,976 (GRCm39)	missense	possibly damaging	0.60
R8468:Speg	UTSW	1	75,407,953 (GRCm39)	missense	probably damaging	1.00
R8555:Speg	UTSW	1	75,378,908 (GRCm39)	splice site	probably null
R8781:Speg	UTSW	1	75,383,665 (GRCm39)	missense	probably damaging	1.00
R8784:Speg	UTSW	1	75,381,793 (GRCm39)	critical splice donor site	probably benign
R8848:Speg	UTSW	1	75,404,082 (GRCm39)	critical splice donor site	probably null
R8881:Speg	UTSW	1	75,377,795 (GRCm39)	missense	possibly damaging	0.67
R8898:Speg	UTSW	1	75,365,517 (GRCm39)	missense	probably damaging	1.00
R8935:Speg	UTSW	1	75,399,250 (GRCm39)	missense	probably benign	0.30
R9019:Speg	UTSW	1	75,405,882 (GRCm39)	missense	probably damaging	1.00
R9027:Speg	UTSW	1	75,365,076 (GRCm39)	missense	possibly damaging	0.67
R9066:Speg	UTSW	1	75,361,654 (GRCm39)	missense	probably damaging	0.99
R9092:Speg	UTSW	1	75,399,378 (GRCm39)	missense	probably benign	0.01
R9117:Speg	UTSW	1	75,364,444 (GRCm39)	missense	probably damaging	1.00
R9202:Speg	UTSW	1	75,367,637 (GRCm39)	missense	probably damaging	1.00
R9246:Speg	UTSW	1	75,361,498 (GRCm39)	missense	probably damaging	1.00
R9248:Speg	UTSW	1	75,398,420 (GRCm39)	missense	probably damaging	1.00
R9451:Speg	UTSW	1	75,394,377 (GRCm39)	missense	probably damaging	1.00
R9452:Speg	UTSW	1	75,399,152 (GRCm39)	missense	probably benign
R9475:Speg	UTSW	1	75,364,735 (GRCm39)	missense	probably damaging	1.00
R9476:Speg	UTSW	1	75,377,768 (GRCm39)	missense	probably damaging	0.99
R9510:Speg	UTSW	1	75,377,768 (GRCm39)	missense	probably damaging	0.99
R9519:Speg	UTSW	1	75,392,380 (GRCm39)	missense	probably damaging	1.00
R9528:Speg	UTSW	1	75,364,447 (GRCm39)	missense	possibly damaging	0.78
R9542:Speg	UTSW	1	75,399,426 (GRCm39)	missense	probably benign	0.08
R9553:Speg	UTSW	1	75,394,645 (GRCm39)	missense	probably benign	0.00
R9767:Speg	UTSW	1	75,403,825 (GRCm39)	missense	possibly damaging	0.78
R9768:Speg	UTSW	1	75,395,617 (GRCm39)	nonsense	probably null
R9800:Speg	UTSW	1	75,399,358 (GRCm39)	missense	probably benign	0.03
X0025:Speg	UTSW	1	75,399,101 (GRCm39)	missense	probably damaging	1.00
X0026:Speg	UTSW	1	75,400,119 (GRCm39)	missense	possibly damaging	0.88
Z1176:Speg	UTSW	1	75,383,238 (GRCm39)	missense	probably damaging	1.00
Z1177:Speg	UTSW	1	75,404,327 (GRCm39)	missense	probably damaging	1.00
Z1177:Speg	UTSW	1	75,407,099 (GRCm39)	missense	probably damaging	0.99
Z1177:Speg	UTSW	1	75,405,025 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCGTTACCTGGACTCATTTTGG -3'
(R):5'- CCAGATGTGCACAGCTATACC -3'

Sequencing Primer
(F):5'- GGTTCACCACTCTGAATATACTGAG -3'
(R):5'- GATGTGCACAGCTATACCCTCCTG -3'

Posted On

2017-06-26