Incidental Mutation 'R5985:Gria4'
ID481614
Institutional Source Beutler Lab
Gene Symbol Gria4
Ensembl Gene ENSMUSG00000025892
Gene Nameglutamate receptor, ionotropic, AMPA4 (alpha 4)
SynonymsGluralpha4, spkw1, Glur4, Glur-4
MMRRC Submission 044165-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.615) question?
Stock #R5985 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location4417896-4796234 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 4503593 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 341 (Q341R)
Ref Sequence ENSEMBL: ENSMUSP00000129316 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027020] [ENSMUST00000063508] [ENSMUST00000163309] [ENSMUST00000212533]
Predicted Effect probably benign
Transcript: ENSMUST00000027020
AA Change: Q341R

PolyPhen 2 Score 0.191 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000027020
Gene: ENSMUSG00000025892
AA Change: Q341R

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 39 380 3e-61 PFAM
PBPe 416 791 8.23e-129 SMART
Lig_chan-Glu_bd 426 491 3.4e-31 SMART
low complexity region 821 833 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000063508
AA Change: Q341R

PolyPhen 2 Score 0.191 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000066980
Gene: ENSMUSG00000025892
AA Change: Q341R

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 39 380 2.5e-71 PFAM
PBPe 416 791 2.06e-129 SMART
Lig_chan-Glu_bd 426 491 3.4e-31 SMART
low complexity region 821 833 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000163309
AA Change: Q341R

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000129316
Gene: ENSMUSG00000025892
AA Change: Q341R

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 39 380 3.2e-62 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000212533
AA Change: Q341R

PolyPhen 2 Score 0.191 (Sensitivity: 0.92; Specificity: 0.87)
Meta Mutation Damage Score 0.106 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.2%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. These receptors are heteromeric protein complexes composed of multiple subunits, arranged to form ligand-gated ion channels. The classification of glutamate receptors is based on their activation by different pharmacologic agonists. The subunit encoded by this gene belongs to a family of AMPA (alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate)-sensitive glutamate receptors, and is subject to RNA editing (AGA->GGA; R->G). Alternative splicing of this gene results in transcript variants encoding different isoforms, which may vary in their signal transduction properties. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation display hyperactivity, decreased thermal nociception, and abnormal sensitivity to pharmacologically induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130011E15Rik A T 19: 45,820,324 Y643N probably damaging Het
Abca13 A C 11: 9,291,628 I1164L probably benign Het
Actn1 C A 12: 80,168,395 G864V probably damaging Het
Adgrf1 T C 17: 43,293,255 I34T probably benign Het
Ankrd10 T A 8: 11,619,077 K225* probably null Het
Ankrd29 G A 18: 12,279,775 A115V probably damaging Het
Atg2a A G 19: 6,254,637 T1175A probably damaging Het
Atp12a A G 14: 56,384,341 D781G probably damaging Het
B4galnt3 G A 6: 120,210,158 P759S probably damaging Het
Card10 T C 15: 78,791,211 I448V probably benign Het
Col15a1 T C 4: 47,284,507 F821L probably damaging Het
Cpeb3 T C 19: 37,087,552 Y498C probably damaging Het
Defb37 A T 8: 18,986,331 C58S probably damaging Het
Faap20 T C 4: 155,250,340 probably benign Het
Frem1 C T 4: 82,966,050 V1204I probably benign Het
Gal3st2 T C 1: 93,873,613 V46A possibly damaging Het
Gan C T 8: 117,195,818 S430L possibly damaging Het
Gas2 T A 7: 51,943,676 I168K probably damaging Het
Gli3 A G 13: 15,723,555 D740G probably damaging Het
Gm15922 C A 7: 3,737,317 G302C probably damaging Het
Gm3898 G A 9: 43,830,032 noncoding transcript Het
Herpud1 G A 8: 94,390,794 R2Q probably damaging Het
Klf15 G A 6: 90,466,721 G93R possibly damaging Het
Mtmr7 A G 8: 40,551,832 F568L probably benign Het
Myod1 A G 7: 46,377,798 Y229C probably damaging Het
Olfr1150-ps1 A G 2: 87,357,605 I54V probably benign Het
Olfr1156 A G 2: 87,949,321 M304T probably benign Het
Phf11b A G 14: 59,321,578 L235P possibly damaging Het
Plekha6 G C 1: 133,272,307 R208P possibly damaging Het
Prox1 A T 1: 190,146,955 F675L possibly damaging Het
Rnf144a C T 12: 26,317,780 E176K probably benign Het
Safb2 T C 17: 56,563,181 E965G possibly damaging Het
Sik3 A G 9: 46,211,675 N874S probably damaging Het
Slitrk3 T C 3: 73,050,900 I180V probably damaging Het
Speg T C 1: 75,406,684 V1141A possibly damaging Het
Spns1 G A 7: 126,376,730 T84I probably benign Het
Syne2 C G 12: 75,966,159 P2709R probably damaging Het
Terb1 A T 8: 104,451,807 S662T probably benign Het
Terb1 A G 8: 104,482,316 S377P probably damaging Het
Tph1 A G 7: 46,653,781 Y258H probably damaging Het
Trip12 T A 1: 84,725,771 E1881D probably damaging Het
Trpc7 A G 13: 56,810,545 L412P probably damaging Het
Ttll13 C T 7: 80,254,638 A337V probably damaging Het
Ugt2b1 T C 5: 86,919,668 K344E possibly damaging Het
Vmn1r36 T A 6: 66,716,871 I7F probably benign Het
Vmn2r14 A T 5: 109,220,216 N303K possibly damaging Het
Vmn2r25 A G 6: 123,823,628 V585A probably benign Het
Zan A C 5: 137,446,037 probably null Het
Zfp423 A T 8: 87,782,146 N502K possibly damaging Het
Zfp473 C T 7: 44,733,328 R526Q probably damaging Het
Other mutations in Gria4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00814:Gria4 APN 9 4472202 missense probably damaging 0.98
IGL01451:Gria4 APN 9 4503652 missense probably benign 0.04
IGL01533:Gria4 APN 9 4502395 missense probably damaging 1.00
IGL01994:Gria4 APN 9 4537726 missense probably damaging 1.00
IGL02078:Gria4 APN 9 4793878 missense probably damaging 0.98
IGL02183:Gria4 APN 9 4502460 missense probably damaging 1.00
IGL02351:Gria4 APN 9 4456206 missense possibly damaging 0.84
IGL02358:Gria4 APN 9 4456206 missense possibly damaging 0.84
IGL03118:Gria4 APN 9 4793804 splice site probably benign
IGL03131:Gria4 APN 9 4432876 missense probably damaging 0.96
IGL03148:Gria4 APN 9 4464295 missense possibly damaging 0.91
IGL03264:Gria4 APN 9 4513288 missense probably benign
PIT4812001:Gria4 UTSW 9 4427128 missense probably damaging 1.00
R0018:Gria4 UTSW 9 4432843 missense possibly damaging 0.71
R0295:Gria4 UTSW 9 4793840 missense possibly damaging 0.69
R0654:Gria4 UTSW 9 4464372 missense probably benign 0.32
R0690:Gria4 UTSW 9 4427071 missense probably damaging 1.00
R0992:Gria4 UTSW 9 4795238 missense probably benign
R1517:Gria4 UTSW 9 4793865 missense probably damaging 1.00
R1673:Gria4 UTSW 9 4537637 nonsense probably null
R1713:Gria4 UTSW 9 4424448 missense probably benign 0.20
R1961:Gria4 UTSW 9 4519546 splice site probably benign
R2137:Gria4 UTSW 9 4427026 intron probably benign
R2397:Gria4 UTSW 9 4537717 missense probably damaging 1.00
R2870:Gria4 UTSW 9 4503614 missense probably damaging 0.96
R2870:Gria4 UTSW 9 4503614 missense probably damaging 0.96
R3014:Gria4 UTSW 9 4464294 missense probably damaging 0.97
R3412:Gria4 UTSW 9 4513278 missense probably benign 0.00
R3732:Gria4 UTSW 9 4513295 missense probably benign
R3732:Gria4 UTSW 9 4513295 missense probably benign
R3733:Gria4 UTSW 9 4513295 missense probably benign
R3897:Gria4 UTSW 9 4513260 missense probably damaging 1.00
R4404:Gria4 UTSW 9 4464489 splice site probably null
R4457:Gria4 UTSW 9 4427074 missense probably damaging 1.00
R4672:Gria4 UTSW 9 4664981 missense possibly damaging 0.96
R4865:Gria4 UTSW 9 4464295 missense possibly damaging 0.91
R5092:Gria4 UTSW 9 4472176 missense probably benign 0.01
R5109:Gria4 UTSW 9 4472168 missense probably damaging 1.00
R5202:Gria4 UTSW 9 4424330 missense probably benign 0.10
R5828:Gria4 UTSW 9 4432832 missense probably damaging 1.00
R5945:Gria4 UTSW 9 4456122 missense probably damaging 1.00
R6036:Gria4 UTSW 9 4537646 missense probably benign 0.00
R6036:Gria4 UTSW 9 4537646 missense probably benign 0.00
R6111:Gria4 UTSW 9 4502430 missense probably damaging 1.00
R6190:Gria4 UTSW 9 4420199 missense probably benign
R6280:Gria4 UTSW 9 4456072 missense probably damaging 1.00
R6406:Gria4 UTSW 9 4427077 missense probably damaging 1.00
R6470:Gria4 UTSW 9 4503680 missense probably damaging 1.00
R6485:Gria4 UTSW 9 4464249 missense probably damaging 1.00
R6612:Gria4 UTSW 9 4472206 missense possibly damaging 0.93
R6848:Gria4 UTSW 9 4793822 missense probably damaging 1.00
R7046:Gria4 UTSW 9 4420278 missense probably damaging 0.97
R7210:Gria4 UTSW 9 4464135 missense probably damaging 1.00
R7284:Gria4 UTSW 9 4472017 missense probably damaging 1.00
R7475:Gria4 UTSW 9 4513330 missense probably damaging 1.00
X0023:Gria4 UTSW 9 4427067 missense probably damaging 1.00
X0065:Gria4 UTSW 9 4464340 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- TGGAATACTGGACTCTTGATAACC -3'
(R):5'- TGTCATAAGCCCACAGAGCTC -3'

Sequencing Primer
(F):5'- ATGCATATACAGAATAACCACTGC -3'
(R):5'- ACAGAGCTCCAAGATTTCTCTTTGTG -3'
Posted On2017-06-26