Incidental Mutation 'R5986:Chl1'
ID481647
Institutional Source Beutler Lab
Gene Symbol Chl1
Ensembl Gene ENSMUSG00000030077
Gene Namecell adhesion molecule L1-like
SynonymsA530023M13Rik, LICAM2, close homolog of L1, CALL
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.311) question?
Stock #R5986 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location103510586-103750211 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 103709191 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Isoleucine at position 954 (L954I)
Ref Sequence ENSEMBL: ENSMUSP00000145026 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066905] [ENSMUST00000203830] [ENSMUST00000203912] [ENSMUST00000205098]
Predicted Effect probably benign
Transcript: ENSMUST00000066905
AA Change: L938I

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000063933
Gene: ENSMUSG00000030077
AA Change: L938I

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
IG_like 48 116 3.14e-2 SMART
IG 138 225 1.36e-5 SMART
IGc2 253 317 3.76e-17 SMART
IGc2 343 408 1.61e-7 SMART
IGc2 436 501 1.56e-5 SMART
IG 521 609 6.02e-7 SMART
IG_like 539 598 1.27e-1 SMART
FN3 612 695 2.24e-13 SMART
FN3 712 794 1.92e-3 SMART
FN3 810 901 2.3e-1 SMART
FN3 916 1002 4.09e-7 SMART
transmembrane domain 1082 1104 N/A INTRINSIC
Pfam:Bravo_FIGEY 1105 1190 3.9e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203830
AA Change: L938I

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000144758
Gene: ENSMUSG00000030077
AA Change: L938I

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
IG_like 48 116 3.14e-2 SMART
IG 138 225 1.36e-5 SMART
IGc2 253 317 3.76e-17 SMART
IGc2 343 408 1.61e-7 SMART
IGc2 436 501 1.56e-5 SMART
IG 521 609 6.02e-7 SMART
IG_like 539 598 1.27e-1 SMART
FN3 612 695 2.24e-13 SMART
FN3 712 794 1.92e-3 SMART
FN3 810 901 2.3e-1 SMART
FN3 916 1002 4.09e-7 SMART
transmembrane domain 1082 1104 N/A INTRINSIC
Pfam:Bravo_FIGEY 1105 1190 3.9e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203912
AA Change: L954I

PolyPhen 2 Score 0.450 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000145026
Gene: ENSMUSG00000030077
AA Change: L954I

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
IG_like 48 116 3.14e-2 SMART
IG 138 225 1.36e-5 SMART
IGc2 269 333 3.76e-17 SMART
IGc2 359 424 1.61e-7 SMART
IGc2 452 517 1.56e-5 SMART
IG 537 625 6.02e-7 SMART
IG_like 555 614 1.27e-1 SMART
FN3 628 711 2.24e-13 SMART
FN3 728 810 1.92e-3 SMART
FN3 826 917 2.3e-1 SMART
FN3 932 1018 4.09e-7 SMART
transmembrane domain 1044 1066 N/A INTRINSIC
Pfam:Bravo_FIGEY 1067 1131 2.5e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205098
AA Change: L211I

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000144739
Gene: ENSMUSG00000030077
AA Change: L211I

DomainStartEndE-ValueType
FN3 4 67 4.4e-1 SMART
FN3 83 174 1.2e-3 SMART
FN3 189 275 2.1e-9 SMART
transmembrane domain 301 323 N/A INTRINSIC
Pfam:Bravo_FIGEY 324 409 3.6e-30 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the L1 gene family of neural cell adhesion molecules. It is a neural recognition molecule that may be involved in signal transduction pathways. The deletion of one copy of this gene may be responsible for mental defects in patients with 3p- syndrome. This protein may also play a role in the growth of certain cancers. Alternate splicing results in both coding and non-coding variants. [provided by RefSeq, Nov 2011]
PHENOTYPE: Homozygous mutation of this gene results in enlargement of the lateral ventricles and altered hippocampal mossy fiber organization. Mutant animals exhibit altered exploratory behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011H14Rik A T 14: 49,232,946 L172H probably damaging Het
Agl A T 3: 116,772,496 F992I probably damaging Het
Ampd1 T C 3: 103,085,397 F152L probably damaging Het
Ank2 T C 3: 127,012,686 H602R possibly damaging Het
Ankib1 T C 5: 3,747,071 D247G probably damaging Het
Bccip T A 7: 133,720,865 H313Q probably benign Het
Ccdc94 G A 17: 55,962,030 C46Y probably damaging Het
Cep250 A G 2: 155,979,277 E929G probably damaging Het
Cog5 A T 12: 31,660,717 D32V probably benign Het
Cyp4f16 C A 17: 32,544,142 A187E probably benign Het
Dffb A T 4: 153,965,593 V271E probably damaging Het
Dnah8 A G 17: 30,851,630 Y4430C possibly damaging Het
Dpp3 T C 19: 4,918,357 E229G probably benign Het
Fat3 T A 9: 15,998,317 N2130Y probably benign Het
Gm13128 G T 4: 144,332,753 V345F probably damaging Het
Kcnk3 T C 5: 30,588,378 V21A possibly damaging Het
Kif9 G A 9: 110,490,026 S186N probably benign Het
Lhfpl3 C A 5: 22,746,426 N78K probably benign Het
Ly6c1 A G 15: 75,045,608 S64P probably damaging Het
Mapk10 T C 5: 103,038,580 T59A probably benign Het
Mars A T 10: 127,304,302 C394* probably null Het
Mettl16 T A 11: 74,792,237 D168E possibly damaging Het
Mgat2 A T 12: 69,185,384 Q244L probably benign Het
Mrps30 A G 13: 118,384,565 probably null Het
Myrip C A 9: 120,461,421 A702E probably damaging Het
Nepn T C 10: 52,404,072 L420P probably damaging Het
Nrn1 A T 13: 36,734,264 Y9* probably null Het
Nup107 T C 10: 117,759,176 Y752C probably damaging Het
Nutm2 A T 13: 50,474,460 D520V probably damaging Het
Olfm2 C T 9: 20,675,650 C48Y probably damaging Het
Olfr27 A G 9: 39,144,982 N294S probably null Het
Olfr592 T C 7: 103,187,528 F309S possibly damaging Het
Osbpl1a T A 18: 12,905,081 D271V probably damaging Het
Osmr G T 15: 6,844,453 D154E probably benign Het
Pcdh9 A G 14: 93,887,048 V562A probably damaging Het
Peak1 A C 9: 56,259,442 S401A probably benign Het
Pigk A T 3: 152,740,849 H195L probably benign Het
Plekha6 G C 1: 133,272,307 R208P possibly damaging Het
Ppp2r1a C T 17: 20,951,346 R28C probably damaging Het
Ptbp3 T C 4: 59,493,311 D123G probably benign Het
Ptgr2 G A 12: 84,308,346 E285K possibly damaging Het
Rassf1 G T 9: 107,551,822 V76L possibly damaging Het
Sec22a A G 16: 35,314,091 V307A probably damaging Het
Skint5 C T 4: 113,995,648 V18I probably benign Het
Slc1a5 T C 7: 16,782,226 V109A probably benign Het
St8sia5 T A 18: 77,254,782 M396K possibly damaging Het
Tiam1 T C 16: 89,789,186 E602G probably benign Het
Tll1 T C 8: 64,074,263 E408G probably damaging Het
Tpsb2 G A 17: 25,367,134 V109M probably benign Het
Trib1 T A 15: 59,654,602 probably null Het
Trio G T 15: 27,851,933 A765E possibly damaging Het
Uggt2 A T 14: 119,049,426 V193E probably damaging Het
Vmn1r115 G A 7: 20,844,522 P155L probably benign Het
Wdr31 A G 4: 62,455,876 L292S probably benign Het
Xrra1 T C 7: 99,876,255 I127T probably benign Het
Zfp442 G A 2: 150,408,024 Q596* probably null Het
Other mutations in Chl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00590:Chl1 APN 6 103693061 missense probably benign 0.08
IGL00786:Chl1 APN 6 103675145 missense probably damaging 1.00
IGL00959:Chl1 APN 6 103709250 splice site probably null
IGL01109:Chl1 APN 6 103715393 missense probably damaging 1.00
IGL01354:Chl1 APN 6 103665853 missense probably benign 0.01
IGL01367:Chl1 APN 6 103729225 missense probably benign 0.42
IGL01371:Chl1 APN 6 103715364 missense probably damaging 1.00
IGL01599:Chl1 APN 6 103708484 missense probably benign 0.34
IGL01724:Chl1 APN 6 103649573 missense probably damaging 1.00
IGL02001:Chl1 APN 6 103642056 missense possibly damaging 0.90
IGL02066:Chl1 APN 6 103698224 missense probably benign 0.39
IGL02122:Chl1 APN 6 103675137 missense probably benign 0.39
IGL02340:Chl1 APN 6 103698125 missense probably damaging 1.00
IGL02420:Chl1 APN 6 103715369 missense probably damaging 1.00
IGL02421:Chl1 APN 6 103717580 missense probably damaging 1.00
IGL02429:Chl1 APN 6 103664809 unclassified probably benign
IGL02825:Chl1 APN 6 103668803 missense possibly damaging 0.87
IGL02858:Chl1 APN 6 103641988 missense probably damaging 1.00
IGL03169:Chl1 APN 6 103665967 missense probably damaging 1.00
IGL03185:Chl1 APN 6 103665863 missense probably damaging 1.00
IGL03189:Chl1 APN 6 103683207 missense possibly damaging 0.91
IGL03288:Chl1 APN 6 103675097 missense probably damaging 1.00
IGL03404:Chl1 APN 6 103693091 missense probably damaging 1.00
IGL03052:Chl1 UTSW 6 103691667 missense probably benign 0.01
R0060:Chl1 UTSW 6 103711058 splice site probably benign
R0060:Chl1 UTSW 6 103711058 splice site probably benign
R0062:Chl1 UTSW 6 103749652 missense unknown
R0314:Chl1 UTSW 6 103647301 missense probably damaging 1.00
R0322:Chl1 UTSW 6 103701883 splice site probably benign
R0685:Chl1 UTSW 6 103708542 splice site probably null
R0702:Chl1 UTSW 6 103706622 missense probably damaging 1.00
R1056:Chl1 UTSW 6 103675077 missense possibly damaging 0.66
R1138:Chl1 UTSW 6 103693179 missense probably benign 0.05
R1483:Chl1 UTSW 6 103647287 missense probably damaging 1.00
R1571:Chl1 UTSW 6 103708484 missense probably benign 0.34
R1620:Chl1 UTSW 6 103690242 missense probably benign 0.00
R1645:Chl1 UTSW 6 103683180 missense probably benign 0.06
R1773:Chl1 UTSW 6 103647331 critical splice donor site probably null
R1852:Chl1 UTSW 6 103699159 utr 5 prime probably null
R1891:Chl1 UTSW 6 103714583 missense possibly damaging 0.88
R2146:Chl1 UTSW 6 103715401 critical splice donor site probably null
R2147:Chl1 UTSW 6 103715401 critical splice donor site probably null
R2148:Chl1 UTSW 6 103715401 critical splice donor site probably null
R2163:Chl1 UTSW 6 103711231 missense probably damaging 1.00
R2291:Chl1 UTSW 6 103715393 missense probably damaging 1.00
R2920:Chl1 UTSW 6 103695343 missense probably damaging 1.00
R3611:Chl1 UTSW 6 103698155 missense probably damaging 1.00
R3979:Chl1 UTSW 6 103715284 nonsense probably null
R4987:Chl1 UTSW 6 103674977 missense probably damaging 1.00
R5266:Chl1 UTSW 6 103700543 missense probably damaging 1.00
R5478:Chl1 UTSW 6 103683221 missense probably damaging 1.00
R5523:Chl1 UTSW 6 103708714 missense probably damaging 1.00
R5887:Chl1 UTSW 6 103717604 missense probably benign 0.00
R6101:Chl1 UTSW 6 103693032 missense probably damaging 0.96
R6179:Chl1 UTSW 6 103683243 missense probably benign 0.38
R6366:Chl1 UTSW 6 103729236 missense possibly damaging 0.95
R6634:Chl1 UTSW 6 103690259 missense probably damaging 1.00
R6824:Chl1 UTSW 6 103714549 missense probably damaging 1.00
R6913:Chl1 UTSW 6 103665948 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGCTGCCACTTATGCAAATTAC -3'
(R):5'- AGGCACATTACTGATCCCTGTG -3'

Sequencing Primer
(F):5'- CTCATAGGAGTTTACATCTGAGTTTC -3'
(R):5'- ATCCCTGTGCTATAAGGAATAGTGG -3'
Posted On2017-06-26