Incidental Mutation 'R5986:Olfm2'
ID481655
Institutional Source Beutler Lab
Gene Symbol Olfm2
Ensembl Gene ENSMUSG00000032172
Gene Nameolfactomedin 2
SynonymsA030009A06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.276) question?
Stock #R5986 (G1)
Quality Score152.008
Status Not validated
Chromosome9
Chromosomal Location20667690-20746349 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 20675650 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 48 (C48Y)
Ref Sequence ENSEMBL: ENSMUSP00000149231 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034692] [ENSMUST00000215999] [ENSMUST00000217198]
Predicted Effect probably damaging
Transcript: ENSMUST00000034692
AA Change: C40Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034692
Gene: ENSMUSG00000032172
AA Change: C40Y

DomainStartEndE-ValueType
Pfam:Noelin-1 19 118 3.8e-44 PFAM
Blast:OLF 132 177 2e-18 BLAST
OLF 190 440 4.32e-123 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215039
Predicted Effect probably damaging
Transcript: ENSMUST00000215999
AA Change: C48Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000217198
AA Change: C70Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit moderate locomotor and anxiety-related behavioral abnormalities, altered visual evoked potential, and reduced compactness of myelin sheaths in the optic nerve. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011H14Rik A T 14: 49,232,946 L172H probably damaging Het
Agl A T 3: 116,772,496 F992I probably damaging Het
Ampd1 T C 3: 103,085,397 F152L probably damaging Het
Ank2 T C 3: 127,012,686 H602R possibly damaging Het
Ankib1 T C 5: 3,747,071 D247G probably damaging Het
Bccip T A 7: 133,720,865 H313Q probably benign Het
Ccdc94 G A 17: 55,962,030 C46Y probably damaging Het
Cep250 A G 2: 155,979,277 E929G probably damaging Het
Chl1 C A 6: 103,709,191 L954I probably benign Het
Cog5 A T 12: 31,660,717 D32V probably benign Het
Cyp4f16 C A 17: 32,544,142 A187E probably benign Het
Dffb A T 4: 153,965,593 V271E probably damaging Het
Dnah8 A G 17: 30,851,630 Y4430C possibly damaging Het
Dpp3 T C 19: 4,918,357 E229G probably benign Het
Fat3 T A 9: 15,998,317 N2130Y probably benign Het
Gm13128 G T 4: 144,332,753 V345F probably damaging Het
Kcnk3 T C 5: 30,588,378 V21A possibly damaging Het
Kif9 G A 9: 110,490,026 S186N probably benign Het
Lhfpl3 C A 5: 22,746,426 N78K probably benign Het
Ly6c1 A G 15: 75,045,608 S64P probably damaging Het
Mapk10 T C 5: 103,038,580 T59A probably benign Het
Mars A T 10: 127,304,302 C394* probably null Het
Mettl16 T A 11: 74,792,237 D168E possibly damaging Het
Mgat2 A T 12: 69,185,384 Q244L probably benign Het
Mrps30 A G 13: 118,384,565 probably null Het
Myrip C A 9: 120,461,421 A702E probably damaging Het
Nepn T C 10: 52,404,072 L420P probably damaging Het
Nrn1 A T 13: 36,734,264 Y9* probably null Het
Nup107 T C 10: 117,759,176 Y752C probably damaging Het
Nutm2 A T 13: 50,474,460 D520V probably damaging Het
Olfr27 A G 9: 39,144,982 N294S probably null Het
Olfr592 T C 7: 103,187,528 F309S possibly damaging Het
Osbpl1a T A 18: 12,905,081 D271V probably damaging Het
Osmr G T 15: 6,844,453 D154E probably benign Het
Pcdh9 A G 14: 93,887,048 V562A probably damaging Het
Peak1 A C 9: 56,259,442 S401A probably benign Het
Pigk A T 3: 152,740,849 H195L probably benign Het
Plekha6 G C 1: 133,272,307 R208P possibly damaging Het
Ppp2r1a C T 17: 20,951,346 R28C probably damaging Het
Ptbp3 T C 4: 59,493,311 D123G probably benign Het
Ptgr2 G A 12: 84,308,346 E285K possibly damaging Het
Rassf1 G T 9: 107,551,822 V76L possibly damaging Het
Sec22a A G 16: 35,314,091 V307A probably damaging Het
Skint5 C T 4: 113,995,648 V18I probably benign Het
Slc1a5 T C 7: 16,782,226 V109A probably benign Het
St8sia5 T A 18: 77,254,782 M396K possibly damaging Het
Tiam1 T C 16: 89,789,186 E602G probably benign Het
Tll1 T C 8: 64,074,263 E408G probably damaging Het
Tpsb2 G A 17: 25,367,134 V109M probably benign Het
Trib1 T A 15: 59,654,602 probably null Het
Trio G T 15: 27,851,933 A765E possibly damaging Het
Uggt2 A T 14: 119,049,426 V193E probably damaging Het
Vmn1r115 G A 7: 20,844,522 P155L probably benign Het
Wdr31 A G 4: 62,455,876 L292S probably benign Het
Xrra1 T C 7: 99,876,255 I127T probably benign Het
Zfp442 G A 2: 150,408,024 Q596* probably null Het
Other mutations in Olfm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02105:Olfm2 APN 9 20672180 missense probably damaging 1.00
IGL03276:Olfm2 APN 9 20668787 splice site probably benign
IGL03352:Olfm2 APN 9 20668723 missense probably damaging 1.00
R0015:Olfm2 UTSW 9 20668741 missense probably damaging 1.00
R0847:Olfm2 UTSW 9 20668657 missense probably damaging 1.00
R1051:Olfm2 UTSW 9 20668463 missense probably damaging 1.00
R3730:Olfm2 UTSW 9 20672767 missense probably damaging 1.00
R5366:Olfm2 UTSW 9 20668412 missense probably benign 0.04
R5665:Olfm2 UTSW 9 20668544 unclassified probably null
R6046:Olfm2 UTSW 9 20668528 missense probably damaging 1.00
R6709:Olfm2 UTSW 9 20672713 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCCAGCTGGATCTTTTGTGG -3'
(R):5'- TTTCCCCACGTGTGCATGTG -3'

Sequencing Primer
(F):5'- TGGTTTAGCCTAGATGGTGACAG -3'
(R):5'- ACCTTGTTTGAGACAGAGCC -3'
Posted On2017-06-26