Incidental Mutation 'R5986:Olfr27'
ID481656
Institutional Source Beutler Lab
Gene Symbol Olfr27
Ensembl Gene ENSMUSG00000049708
Gene Nameolfactory receptor 27
SynonymsMOR171-6, GA_x6K02T2PVTD-32841223-32842158, MTPCR56
MMRRC Submission 044166-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.034) question?
Stock #R5986 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location39128131-39145072 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 39144982 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 294 (N294S)
Ref Sequence ENSEMBL: ENSMUSP00000150009 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000214052] [ENSMUST00000216405]
Predicted Effect probably null
Transcript: ENSMUST00000057811
AA Change: N294S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110642
Gene: ENSMUSG00000049708
AA Change: N294S

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.6e-49 PFAM
Pfam:7tm_1 41 290 2.4e-20 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000214052
AA Change: N294S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably null
Transcript: ENSMUST00000216405
AA Change: N294S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011H14Rik A T 14: 49,232,946 L172H probably damaging Het
Agl A T 3: 116,772,496 F992I probably damaging Het
Ampd1 T C 3: 103,085,397 F152L probably damaging Het
Ank2 T C 3: 127,012,686 H602R possibly damaging Het
Ankib1 T C 5: 3,747,071 D247G probably damaging Het
Bccip T A 7: 133,720,865 H313Q probably benign Het
Ccdc94 G A 17: 55,962,030 C46Y probably damaging Het
Cep250 A G 2: 155,979,277 E929G probably damaging Het
Chl1 C A 6: 103,709,191 L954I probably benign Het
Cog5 A T 12: 31,660,717 D32V probably benign Het
Cyp4f16 C A 17: 32,544,142 A187E probably benign Het
Dffb A T 4: 153,965,593 V271E probably damaging Het
Dnah8 A G 17: 30,851,630 Y4430C possibly damaging Het
Dpp3 T C 19: 4,918,357 E229G probably benign Het
Fat3 T A 9: 15,998,317 N2130Y probably benign Het
Gm13128 G T 4: 144,332,753 V345F probably damaging Het
Kcnk3 T C 5: 30,588,378 V21A possibly damaging Het
Kif9 G A 9: 110,490,026 S186N probably benign Het
Lhfpl3 C A 5: 22,746,426 N78K probably benign Het
Ly6c1 A G 15: 75,045,608 S64P probably damaging Het
Mapk10 T C 5: 103,038,580 T59A probably benign Het
Mars A T 10: 127,304,302 C394* probably null Het
Mettl16 T A 11: 74,792,237 D168E possibly damaging Het
Mgat2 A T 12: 69,185,384 Q244L probably benign Het
Mrps30 A G 13: 118,384,565 probably null Het
Myrip C A 9: 120,461,421 A702E probably damaging Het
Nepn T C 10: 52,404,072 L420P probably damaging Het
Nrn1 A T 13: 36,734,264 Y9* probably null Het
Nup107 T C 10: 117,759,176 Y752C probably damaging Het
Nutm2 A T 13: 50,474,460 D520V probably damaging Het
Olfm2 C T 9: 20,675,650 C48Y probably damaging Het
Olfr592 T C 7: 103,187,528 F309S possibly damaging Het
Osbpl1a T A 18: 12,905,081 D271V probably damaging Het
Osmr G T 15: 6,844,453 D154E probably benign Het
Pcdh9 A G 14: 93,887,048 V562A probably damaging Het
Peak1 A C 9: 56,259,442 S401A probably benign Het
Pigk A T 3: 152,740,849 H195L probably benign Het
Plekha6 G C 1: 133,272,307 R208P possibly damaging Het
Ppp2r1a C T 17: 20,951,346 R28C probably damaging Het
Ptbp3 T C 4: 59,493,311 D123G probably benign Het
Ptgr2 G A 12: 84,308,346 E285K possibly damaging Het
Rassf1 G T 9: 107,551,822 V76L possibly damaging Het
Sec22a A G 16: 35,314,091 V307A probably damaging Het
Skint5 C T 4: 113,995,648 V18I probably benign Het
Slc1a5 T C 7: 16,782,226 V109A probably benign Het
St8sia5 T A 18: 77,254,782 M396K possibly damaging Het
Tiam1 T C 16: 89,789,186 E602G probably benign Het
Tll1 T C 8: 64,074,263 E408G probably damaging Het
Tpsb2 G A 17: 25,367,134 V109M probably benign Het
Trib1 T A 15: 59,654,602 probably null Het
Trio G T 15: 27,851,933 A765E possibly damaging Het
Uggt2 A T 14: 119,049,426 V193E probably damaging Het
Vmn1r115 G A 7: 20,844,522 P155L probably benign Het
Wdr31 A G 4: 62,455,876 L292S probably benign Het
Xrra1 T C 7: 99,876,255 I127T probably benign Het
Zfp442 G A 2: 150,408,024 Q596* probably null Het
Other mutations in Olfr27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Olfr27 APN 9 39144757 missense possibly damaging 0.94
IGL00905:Olfr27 APN 9 39145030 missense probably damaging 1.00
IGL02346:Olfr27 APN 9 39144643 missense probably damaging 1.00
R0117:Olfr27 UTSW 9 39144850 missense probably damaging 1.00
R0118:Olfr27 UTSW 9 39144103 start codon destroyed probably null 0.97
R0590:Olfr27 UTSW 9 39144721 missense probably benign 0.01
R2915:Olfr27 UTSW 9 39144466 missense possibly damaging 0.94
R4299:Olfr27 UTSW 9 39144999 missense probably benign 0.11
R4367:Olfr27 UTSW 9 39144429 missense probably damaging 0.98
R4663:Olfr27 UTSW 9 39144849 missense probably damaging 0.97
R5276:Olfr27 UTSW 9 39144315 missense probably damaging 1.00
R5503:Olfr27 UTSW 9 39144484 missense probably benign 0.02
R5742:Olfr27 UTSW 9 39144678 missense probably benign 0.07
R6801:Olfr27 UTSW 9 39144210 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCTGCATTCACTCCAGGGAG -3'
(R):5'- GAGGGACCACTTAAAATTACAGCAC -3'

Sequencing Primer
(F):5'- AGGGCAAGTTCAAGGCTTTTAGTAC -3'
(R):5'- TGTAGAACATTCAGAGGATGGAC -3'
Posted On2017-06-26