Incidental Mutation 'R5986:Trio'
ID481675
Institutional Source Beutler Lab
Gene Symbol Trio
Ensembl Gene ENSMUSG00000022263
Gene Nametriple functional domain (PTPRF interacting)
SynonymsSolo, 6720464I07Rik
MMRRC Submission 044166-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5986 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location27730651-28025848 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 27851933 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 765 (A765E)
Ref Sequence ENSEMBL: ENSMUSP00000154653 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090247] [ENSMUST00000227337]
Predicted Effect probably benign
Transcript: ENSMUST00000090247
AA Change: A824E

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000087714
Gene: ENSMUSG00000022263
AA Change: A824E

DomainStartEndE-ValueType
low complexity region 2 40 N/A INTRINSIC
SEC14 68 207 3.4e-26 SMART
SPEC 221 337 2.48e-9 SMART
SPEC 343 445 1.92e-15 SMART
SPEC 569 671 5.35e-14 SMART
SPEC 674 783 1.18e-6 SMART
SPEC 910 1011 2.6e-12 SMART
SPEC 1141 1243 7e-18 SMART
low complexity region 1249 1258 N/A INTRINSIC
RhoGEF 1296 1466 2.79e-53 SMART
PH 1480 1593 1.53e-9 SMART
SH3 1659 1720 1.9e-8 SMART
low complexity region 1788 1802 N/A INTRINSIC
low complexity region 1837 1863 N/A INTRINSIC
low complexity region 1936 1954 N/A INTRINSIC
RhoGEF 1973 2144 1.32e-63 SMART
PH 2158 2273 3.6e-6 SMART
low complexity region 2291 2341 N/A INTRINSIC
low complexity region 2371 2390 N/A INTRINSIC
low complexity region 2491 2503 N/A INTRINSIC
SH3 2558 2619 1.04e0 SMART
low complexity region 2640 2660 N/A INTRINSIC
IGc2 2701 2770 4e-12 SMART
S_TKc 2800 3054 4.84e-72 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226580
Predicted Effect possibly damaging
Transcript: ENSMUST00000227337
AA Change: A765E

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228765
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large protein that functions as a GDP to GTP exchange factor. This protein promotes the reorganization of the actin cytoskeleton, thereby playing a role in cell migration and growth. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous mutant mice die during late embryonic development or shortly after birth. They exhibit abnormal skeletal myogenesis and display aberrant organization within the hippocampus and olfactory bulb. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011H14Rik A T 14: 49,232,946 L172H probably damaging Het
Agl A T 3: 116,772,496 F992I probably damaging Het
Ampd1 T C 3: 103,085,397 F152L probably damaging Het
Ank2 T C 3: 127,012,686 H602R possibly damaging Het
Ankib1 T C 5: 3,747,071 D247G probably damaging Het
Bccip T A 7: 133,720,865 H313Q probably benign Het
Ccdc94 G A 17: 55,962,030 C46Y probably damaging Het
Cep250 A G 2: 155,979,277 E929G probably damaging Het
Chl1 C A 6: 103,709,191 L954I probably benign Het
Cog5 A T 12: 31,660,717 D32V probably benign Het
Cyp4f16 C A 17: 32,544,142 A187E probably benign Het
Dffb A T 4: 153,965,593 V271E probably damaging Het
Dnah8 A G 17: 30,851,630 Y4430C possibly damaging Het
Dpp3 T C 19: 4,918,357 E229G probably benign Het
Fat3 T A 9: 15,998,317 N2130Y probably benign Het
Gm13128 G T 4: 144,332,753 V345F probably damaging Het
Kcnk3 T C 5: 30,588,378 V21A possibly damaging Het
Kif9 G A 9: 110,490,026 S186N probably benign Het
Lhfpl3 C A 5: 22,746,426 N78K probably benign Het
Ly6c1 A G 15: 75,045,608 S64P probably damaging Het
Mapk10 T C 5: 103,038,580 T59A probably benign Het
Mars A T 10: 127,304,302 C394* probably null Het
Mettl16 T A 11: 74,792,237 D168E possibly damaging Het
Mgat2 A T 12: 69,185,384 Q244L probably benign Het
Mrps30 A G 13: 118,384,565 probably null Het
Myrip C A 9: 120,461,421 A702E probably damaging Het
Nepn T C 10: 52,404,072 L420P probably damaging Het
Nrn1 A T 13: 36,734,264 Y9* probably null Het
Nup107 T C 10: 117,759,176 Y752C probably damaging Het
Nutm2 A T 13: 50,474,460 D520V probably damaging Het
Olfm2 C T 9: 20,675,650 C48Y probably damaging Het
Olfr27 A G 9: 39,144,982 N294S probably null Het
Olfr592 T C 7: 103,187,528 F309S possibly damaging Het
Osbpl1a T A 18: 12,905,081 D271V probably damaging Het
Osmr G T 15: 6,844,453 D154E probably benign Het
Pcdh9 A G 14: 93,887,048 V562A probably damaging Het
Peak1 A C 9: 56,259,442 S401A probably benign Het
Pigk A T 3: 152,740,849 H195L probably benign Het
Plekha6 G C 1: 133,272,307 R208P possibly damaging Het
Ppp2r1a C T 17: 20,951,346 R28C probably damaging Het
Ptbp3 T C 4: 59,493,311 D123G probably benign Het
Ptgr2 G A 12: 84,308,346 E285K possibly damaging Het
Rassf1 G T 9: 107,551,822 V76L possibly damaging Het
Sec22a A G 16: 35,314,091 V307A probably damaging Het
Skint5 C T 4: 113,995,648 V18I probably benign Het
Slc1a5 T C 7: 16,782,226 V109A probably benign Het
St8sia5 T A 18: 77,254,782 M396K possibly damaging Het
Tiam1 T C 16: 89,789,186 E602G probably benign Het
Tll1 T C 8: 64,074,263 E408G probably damaging Het
Tpsb2 G A 17: 25,367,134 V109M probably benign Het
Trib1 T A 15: 59,654,602 probably null Het
Uggt2 A T 14: 119,049,426 V193E probably damaging Het
Vmn1r115 G A 7: 20,844,522 P155L probably benign Het
Wdr31 A G 4: 62,455,876 L292S probably benign Het
Xrra1 T C 7: 99,876,255 I127T probably benign Het
Zfp442 G A 2: 150,408,024 Q596* probably null Het
Other mutations in Trio
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00480:Trio APN 15 27912743 splice site probably benign
IGL01011:Trio APN 15 27736489 missense probably damaging 0.96
IGL01090:Trio APN 15 27773007 missense probably damaging 1.00
IGL01145:Trio APN 15 27818167 splice site probably benign
IGL01147:Trio APN 15 27881320 missense probably damaging 1.00
IGL01161:Trio APN 15 27749781 missense probably damaging 1.00
IGL01324:Trio APN 15 27905323 missense probably benign 0.42
IGL01352:Trio APN 15 27901229 missense probably benign 0.01
IGL01366:Trio APN 15 27732868 missense possibly damaging 0.76
IGL01443:Trio APN 15 27838775 splice site probably benign
IGL01454:Trio APN 15 27832985 missense probably benign 0.32
IGL01695:Trio APN 15 27773001 missense probably damaging 1.00
IGL01765:Trio APN 15 27764026 missense possibly damaging 0.85
IGL01860:Trio APN 15 27846810 missense probably damaging 1.00
IGL01879:Trio APN 15 27741033 missense probably benign 0.12
IGL01991:Trio APN 15 27871274 missense possibly damaging 0.95
IGL02106:Trio APN 15 27744158 missense possibly damaging 0.85
IGL02209:Trio APN 15 27744053 missense probably damaging 1.00
IGL02232:Trio APN 15 27902561 missense probably benign 0.24
IGL02304:Trio APN 15 27735436 missense probably damaging 0.96
IGL02504:Trio APN 15 27847390 nonsense probably null
IGL02508:Trio APN 15 27818104 missense possibly damaging 0.65
IGL02541:Trio APN 15 27844930 splice site probably benign
IGL02617:Trio APN 15 27841849 splice site probably benign
IGL02675:Trio APN 15 27768039 unclassified probably benign
IGL02817:Trio APN 15 27902881 missense probably benign 0.01
IGL02993:Trio APN 15 27830239 splice site probably benign
IGL03007:Trio APN 15 27902742 missense probably damaging 0.99
IGL03135:Trio APN 15 27832011 splice site probably benign
IGL03225:Trio APN 15 27902695 missense probably benign 0.30
R0063:Trio UTSW 15 27881437 splice site probably benign
R0063:Trio UTSW 15 27881437 splice site probably benign
R0302:Trio UTSW 15 27902517 missense probably damaging 1.00
R0505:Trio UTSW 15 27767907 missense probably benign 0.00
R0506:Trio UTSW 15 27854963 missense probably benign 0.12
R0564:Trio UTSW 15 27805822 missense probably damaging 1.00
R0659:Trio UTSW 15 27831399 missense probably damaging 0.97
R0882:Trio UTSW 15 27732894 missense probably damaging 1.00
R0939:Trio UTSW 15 27741250 critical splice donor site probably null
R1018:Trio UTSW 15 27871171 missense probably damaging 1.00
R1439:Trio UTSW 15 27897914 missense probably damaging 1.00
R1456:Trio UTSW 15 27753804 splice site probably benign
R1488:Trio UTSW 15 27740967 missense probably damaging 1.00
R1522:Trio UTSW 15 27732640 missense probably benign 0.28
R1531:Trio UTSW 15 27832985 missense probably benign 0.32
R1640:Trio UTSW 15 27833044 missense probably damaging 1.00
R1646:Trio UTSW 15 27758347 missense possibly damaging 0.91
R1682:Trio UTSW 15 27744146 unclassified probably null
R1780:Trio UTSW 15 27744038 missense possibly damaging 0.93
R1791:Trio UTSW 15 27841756 missense probably damaging 1.00
R1803:Trio UTSW 15 27748340 missense probably benign
R1817:Trio UTSW 15 27742495 nonsense probably null
R1853:Trio UTSW 15 27756536 missense probably damaging 1.00
R1898:Trio UTSW 15 27742380 missense possibly damaging 0.52
R1937:Trio UTSW 15 27833056 missense probably damaging 1.00
R1938:Trio UTSW 15 27732891 missense probably damaging 0.98
R2025:Trio UTSW 15 27744137 missense probably damaging 0.99
R2025:Trio UTSW 15 27773927 missense probably damaging 1.00
R2050:Trio UTSW 15 27851945 missense possibly damaging 0.85
R2186:Trio UTSW 15 27823975 splice site probably null
R2913:Trio UTSW 15 27854912 missense probably damaging 1.00
R3151:Trio UTSW 15 27805776 missense probably damaging 1.00
R3771:Trio UTSW 15 27748091 missense probably damaging 0.98
R3773:Trio UTSW 15 27748091 missense probably damaging 0.98
R3826:Trio UTSW 15 27833070 missense probably damaging 1.00
R4015:Trio UTSW 15 27744101 missense possibly damaging 0.71
R4359:Trio UTSW 15 27749797 nonsense probably null
R4370:Trio UTSW 15 27748337 nonsense probably null
R4547:Trio UTSW 15 27818982 missense possibly damaging 0.89
R4573:Trio UTSW 15 27772998 small deletion probably benign
R4620:Trio UTSW 15 27871171 missense probably damaging 1.00
R4735:Trio UTSW 15 27752789 splice site probably null
R4764:Trio UTSW 15 27732538 nonsense probably null
R4775:Trio UTSW 15 27881342 nonsense probably null
R4942:Trio UTSW 15 27752725 missense probably benign 0.21
R5004:Trio UTSW 15 27755178 missense probably damaging 1.00
R5149:Trio UTSW 15 27754029 missense possibly damaging 0.74
R5183:Trio UTSW 15 27902600 missense probably benign 0.00
R5186:Trio UTSW 15 27897991 missense probably damaging 0.97
R5268:Trio UTSW 15 27748286 missense probably benign 0.02
R5344:Trio UTSW 15 27735532 missense probably benign 0.12
R5407:Trio UTSW 15 27844806 splice site probably null
R5442:Trio UTSW 15 27856194 missense probably benign 0.04
R5617:Trio UTSW 15 27902748 missense probably benign
R5778:Trio UTSW 15 27856164 missense probably benign 0.33
R5990:Trio UTSW 15 27891459 missense probably benign 0.10
R6011:Trio UTSW 15 27735545 missense probably damaging 0.98
R6063:Trio UTSW 15 27891379 missense possibly damaging 0.94
R6166:Trio UTSW 15 27818071 missense probably damaging 0.96
R6187:Trio UTSW 15 27743952 critical splice donor site probably null
R6387:Trio UTSW 15 27752739 missense probably damaging 1.00
R6402:Trio UTSW 15 27902911 missense probably benign 0.02
R6478:Trio UTSW 15 27856107 missense probably benign 0.01
R6528:Trio UTSW 15 27805870 missense probably damaging 1.00
R6662:Trio UTSW 15 27854996 missense probably benign 0.00
R6825:Trio UTSW 15 27889308 missense probably damaging 0.98
R6890:Trio UTSW 15 27919288 unclassified probably benign
R6945:Trio UTSW 15 27824090 missense probably damaging 1.00
R7027:Trio UTSW 15 27805654 missense possibly damaging 0.86
R7046:Trio UTSW 15 27832051 missense probably damaging 1.00
R7049:Trio UTSW 15 27749799 missense possibly damaging 0.66
R7075:Trio UTSW 15 27898000 missense unknown
R7094:Trio UTSW 15 27891448 missense unknown
R7123:Trio UTSW 15 27742313 critical splice donor site probably benign
R7130:Trio UTSW 15 27742313 critical splice donor site probably benign
X0024:Trio UTSW 15 27765726 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- AGAATCCATGTTGGCAGGTAATGG -3'
(R):5'- ACCCATGATGGTTGGCTGTC -3'

Sequencing Primer
(F):5'- AGAAGCTGTGGCACTTATAGTCC -3'
(R):5'- GCTGTCCGTTGACTCACAGTG -3'
Posted On2017-06-26