Incidental Mutation 'R0515:Trpv5'
ID48185
Institutional Source Beutler Lab
Gene Symbol Trpv5
Ensembl Gene ENSMUSG00000036899
Gene Nametransient receptor potential cation channel, subfamily V, member 5
SynonymsECaC1, CaT2
MMRRC Submission 038709-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.469) question?
Stock #R0515 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location41652173-41680769 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to A at 41674211 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141421 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031901] [ENSMUST00000193503]
Predicted Effect probably benign
Transcript: ENSMUST00000031901
SMART Domains Protein: ENSMUSP00000031901
Gene: ENSMUSG00000036899

DomainStartEndE-ValueType
Blast:ANK 38 68 1e-7 BLAST
ANK 72 102 2.3e0 SMART
ANK 110 139 4.56e-4 SMART
ANK 156 185 1.85e-4 SMART
Blast:ANK 189 217 3e-10 BLAST
ANK 232 261 3.07e2 SMART
Pfam:Ion_trans 321 583 1.8e-19 PFAM
low complexity region 676 691 N/A INTRINSIC
low complexity region 708 719 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193503
SMART Domains Protein: ENSMUSP00000141421
Gene: ENSMUSG00000036899

DomainStartEndE-ValueType
Blast:ANK 38 68 1e-7 BLAST
ANK 72 102 1.5e-2 SMART
ANK 110 139 2.8e-6 SMART
ANK 156 185 1.2e-6 SMART
Blast:ANK 189 217 4e-10 BLAST
transmembrane domain 274 296 N/A INTRINSIC
Pfam:Ion_trans 335 522 2.7e-12 PFAM
low complexity region 627 642 N/A INTRINSIC
low complexity region 659 670 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the transient receptor family and the TrpV subfamily. The calcium-selective channel encoded by this gene has 6 transmembrane-spanning domains, multiple potential phosphorylation sites, an N-linked glycosylation site, and 5 ANK repeats. This protein forms homotetramers or heterotetramers and is activated by a low internal calcium level. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice exhibit increased calcium excretion and reduced bone thickenss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik A G 2: 130,740,488 V515A probably damaging Het
App C T 16: 85,103,344 probably benign Het
Arhgap11a G A 2: 113,837,471 T395I possibly damaging Het
Arhgef38 T G 3: 133,149,540 H262P probably damaging Het
Cd96 A G 16: 46,063,905 probably benign Het
Cfap57 A G 4: 118,620,402 S2P probably damaging Het
Cltc A G 11: 86,709,039 S948P probably benign Het
Cyp3a41a A T 5: 145,718,000 H30Q probably damaging Het
Dcp2 C T 18: 44,399,731 L105F probably benign Het
Dennd4c T C 4: 86,813,466 V887A possibly damaging Het
Fam46b A T 4: 133,486,139 H107L possibly damaging Het
Gm11360 T A 13: 27,956,160 D2E probably damaging Het
Gpank1 G T 17: 35,123,499 A149S probably damaging Het
Gtf2i C A 5: 134,242,919 S792I probably damaging Het
Hvcn1 A G 5: 122,233,519 N41D probably damaging Het
Klk1b5 A G 7: 44,218,533 Y43C probably damaging Het
Lmtk2 A G 5: 144,174,991 D843G possibly damaging Het
Lrriq1 A T 10: 103,068,968 probably null Het
Mapk8ip1 A T 2: 92,387,356 I198N possibly damaging Het
Mill1 T C 7: 18,264,873 V336A probably benign Het
Mroh7 T A 4: 106,691,664 M1001L probably benign Het
Nfe2 T A 15: 103,249,427 T46S probably null Het
Olfr1500 T C 19: 13,827,821 S192G probably damaging Het
Olfr889 T C 9: 38,116,017 S74P probably damaging Het
Parp4 T C 14: 56,613,667 V709A probably damaging Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Prex2 A T 1: 11,199,874 Q1261L probably damaging Het
Prl8a8 T A 13: 27,508,367 I214L probably damaging Het
Rictor C T 15: 6,769,301 T343M probably damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Siglecf T C 7: 43,355,631 probably null Het
Slco1b2 T C 6: 141,669,410 F347S possibly damaging Het
Sox13 A T 1: 133,383,719 Y592N probably damaging Het
Synj1 C T 16: 90,994,022 A84T possibly damaging Het
Tshz1 A G 18: 84,015,965 V106A probably benign Het
Other mutations in Trpv5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01349:Trpv5 APN 6 41675375 missense possibly damaging 0.87
IGL01704:Trpv5 APN 6 41653258 missense possibly damaging 0.88
IGL01860:Trpv5 APN 6 41660295 missense probably damaging 1.00
IGL01950:Trpv5 APN 6 41675978 missense probably benign 0.09
gingame UTSW 6 41670961 missense probably damaging 1.00
R1581:Trpv5 UTSW 6 41653140 missense probably damaging 1.00
R1633:Trpv5 UTSW 6 41675920 nonsense probably null
R1658:Trpv5 UTSW 6 41674282 missense probably damaging 1.00
R1677:Trpv5 UTSW 6 41657797 missense probably benign 0.44
R1955:Trpv5 UTSW 6 41657937 missense probably damaging 1.00
R2008:Trpv5 UTSW 6 41659728 critical splice acceptor site probably null
R2331:Trpv5 UTSW 6 41659968 missense probably damaging 1.00
R2519:Trpv5 UTSW 6 41674350 missense probably damaging 0.99
R2973:Trpv5 UTSW 6 41653231 missense possibly damaging 0.81
R2974:Trpv5 UTSW 6 41653231 missense possibly damaging 0.81
R3877:Trpv5 UTSW 6 41660343 missense probably benign 0.10
R3923:Trpv5 UTSW 6 41653249 missense probably benign 0.00
R4056:Trpv5 UTSW 6 41659705 missense probably damaging 1.00
R4396:Trpv5 UTSW 6 41657896 missense probably benign 0.00
R4757:Trpv5 UTSW 6 41653214 missense probably damaging 0.98
R5013:Trpv5 UTSW 6 41659713 missense probably damaging 1.00
R5039:Trpv5 UTSW 6 41675945 missense possibly damaging 0.73
R5330:Trpv5 UTSW 6 41660332 missense probably benign 0.06
R5331:Trpv5 UTSW 6 41660332 missense probably benign 0.06
R6270:Trpv5 UTSW 6 41674359 missense possibly damaging 0.94
R6405:Trpv5 UTSW 6 41674668 missense probably damaging 1.00
R6575:Trpv5 UTSW 6 41675969 missense probably benign
R6669:Trpv5 UTSW 6 41658042 missense probably damaging 1.00
R6681:Trpv5 UTSW 6 41653354 missense probably damaging 0.97
R6817:Trpv5 UTSW 6 41658007 missense possibly damaging 0.65
R7021:Trpv5 UTSW 6 41653270 missense probably benign 0.00
R7069:Trpv5 UTSW 6 41675960 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GCCAAGCAGGACGAAAGTAGTCTC -3'
(R):5'- TCTCCGTTCTCCCCAGGAAATACAG -3'

Sequencing Primer
(F):5'- GTAGTCTCAGAAGATAAACATTGGC -3'
(R):5'- GTCAGATGTACAACCTGCTACTG -3'
Posted On2013-06-12