Incidental Mutation 'R5990:Muc16'
ID481949
Institutional Source Beutler Lab
Gene Symbol Muc16
Ensembl Gene ENSMUSG00000109564
Gene Namemucin 16
Synonyms1110008I14Rik, LOC385009
MMRRC Submission 044170-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.164) question?
Stock #R5990 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location18495455-18674530 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 18659243 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 660 (A660V)
Ref Sequence ENSEMBL: ENSMUSP00000147104 (fasta)
Predicted Effect unknown
Transcript: ENSMUST00000208663
AA Change: A660V
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.2%
Validation Efficiency 99% (77/78)
MGI Phenotype PHENOTYPE: Homozygous null mice are viable and fertile with no gross histological abnormalities. Homozygous male mice father larger litters when crossed to wild-type females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610028H24Rik A T 10: 76,449,289 M11L probably benign Het
Acad10 A G 5: 121,645,405 L319P probably damaging Het
Adam12 C A 7: 133,931,736 C471F probably damaging Het
Arfgef1 A G 1: 10,172,921 Y1065H probably damaging Het
Atp8b3 G A 10: 80,525,697 T797M possibly damaging Het
Auts2 G A 5: 131,476,895 probably benign Het
AW209491 C T 13: 14,637,780 A406V probably benign Het
Ccdc146 A G 5: 21,318,182 S286P probably benign Het
Chsy3 GT G 18: 59,176,166 probably null Het
Cmtr1 T C 17: 29,702,161 Y794H probably benign Het
Copb2 A G 9: 98,570,325 E54G probably damaging Het
Ctsk A T 3: 95,501,456 H77L probably damaging Het
Dnah3 T C 7: 120,073,541 Y546C probably benign Het
Ephb2 A T 4: 136,696,055 V304E probably benign Het
Ern1 C T 11: 106,411,769 V420I probably benign Het
Esrrg A T 1: 188,198,798 E339V probably damaging Het
Fbxo10 A C 4: 45,061,960 F189V probably damaging Het
Foxl1 G T 8: 121,128,421 A154S probably damaging Het
Frs3 A G 17: 47,701,677 D103G possibly damaging Het
Gdpd4 A G 7: 98,040,930 T610A probably benign Het
Gm10271 A T 10: 116,972,592 F6L probably damaging Het
Gm4847 C T 1: 166,643,373 S36N probably benign Het
Grm8 G T 6: 27,363,624 L631I probably damaging Het
Ints9 T A 14: 65,039,328 L648Q probably damaging Het
Kansl1l T C 1: 66,735,726 H647R probably damaging Het
Kcnq1 T A 7: 143,261,368 H501Q probably damaging Het
Kctd20 T C 17: 28,966,910 L409P probably benign Het
Kiss1r A G 10: 79,918,707 T12A probably benign Het
Kndc1 T A 7: 139,927,420 V1173E probably damaging Het
Kprp T C 3: 92,824,774 E323G probably damaging Het
Krtap10-4 A T 10: 77,826,607 probably benign Het
Lrrc37a A G 11: 103,500,958 Y1214H probably benign Het
Lysmd3 G A 13: 81,669,588 G228D probably damaging Het
Muc5b T C 7: 141,858,161 C1615R unknown Het
Nans A T 4: 46,489,441 N28I probably damaging Het
Nlrp4b C T 7: 10,714,491 S207L possibly damaging Het
Nrd1 T G 4: 109,019,071 F355V probably damaging Het
Nrip2 C T 6: 128,400,016 probably benign Het
Nufip1 C T 14: 76,114,188 P161L probably damaging Het
Ogdhl C T 14: 32,327,114 H114Y possibly damaging Het
Olfr1295 T A 2: 111,564,674 I257F probably damaging Het
Olfr160 G T 9: 37,712,110 H56Q probably damaging Het
Opa1 T A 16: 29,587,018 W134R probably damaging Het
Parp14 G A 16: 35,841,457 P1403S probably benign Het
Patl2 T C 2: 122,124,484 D361G probably damaging Het
Pcx A G 19: 4,621,266 D1172G probably damaging Het
Phax A G 18: 56,575,603 T58A probably benign Het
Phf11b T A 14: 59,324,926 I177L possibly damaging Het
Pole T A 5: 110,302,144 V819D probably damaging Het
Poll T C 19: 45,553,155 D458G possibly damaging Het
Polr2m G A 9: 71,479,320 probably null Het
Ppp1r9a C A 6: 5,134,660 H928N probably benign Het
Prdm2 T C 4: 143,170,113 N102D probably damaging Het
Rbm45 A T 2: 76,370,412 D95V probably benign Het
Rdh19 A G 10: 127,859,594 M226V probably benign Het
Rev3l T G 10: 39,823,811 S1435A probably benign Het
Rgs20 A G 1: 4,912,330 I305T probably benign Het
Rhobtb2 T C 14: 69,796,369 N469S probably damaging Het
Rif1 C G 2: 52,095,844 L614V probably damaging Het
Rps6ka1 A G 4: 133,866,397 I177T probably damaging Het
Samd12 T A 15: 53,719,623 D105V probably damaging Het
Setd3 A T 12: 108,160,335 D88E probably benign Het
Sfmbt2 G T 2: 10,579,381 V850L possibly damaging Het
Slc26a10 C A 10: 127,178,758 A195S possibly damaging Het
Smcp C A 3: 92,584,250 A97S unknown Het
Stxbp5 G A 10: 9,835,933 H248Y probably damaging Het
Syne2 T C 12: 76,024,144 L4457P probably benign Het
Tbx3 A G 5: 119,680,529 T390A probably benign Het
Tmeff2 G A 1: 50,979,442 W194* probably null Het
Tmem120b G A 5: 123,104,481 R174Q probably damaging Het
Trio A G 15: 27,891,459 V402A probably benign Het
Ttll2 C A 17: 7,352,367 G54W possibly damaging Het
Uba7 G A 9: 107,981,234 V786M probably damaging Het
Vmn2r32 T C 7: 7,479,810 E55G probably damaging Het
Wdr35 A G 12: 9,016,511 D724G probably damaging Het
Xrcc1 G A 7: 24,567,868 V381M probably damaging Het
Zdhhc11 T A 13: 73,979,184 W227R probably benign Het
Zfp341 T C 2: 154,645,659 S681P probably damaging Het
Zfp735 T A 11: 73,690,348 D70E possibly damaging Het
Zmat4 G A 8: 23,929,263 A104T probably damaging Het
Other mutations in Muc16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01330:Muc16 APN 9 18508507 missense possibly damaging 0.89
IGL01878:Muc16 APN 9 18495543 missense possibly damaging 0.90
IGL02394:Muc16 APN 9 18498700 missense probably damaging 0.99
IGL02553:Muc16 APN 9 18498553 critical splice donor site probably null
R0400:Muc16 UTSW 9 18510534 missense possibly damaging 0.74
R1620:Muc16 UTSW 9 18510477 missense possibly damaging 0.89
R1695:Muc16 UTSW 9 18497433 missense probably damaging 1.00
R3196:Muc16 UTSW 9 18497830 missense probably damaging 1.00
R5982:Muc16 UTSW 9 18647146 missense unknown
R6024:Muc16 UTSW 9 18646671 missense unknown
R6026:Muc16 UTSW 9 18659858 missense unknown
R6028:Muc16 UTSW 9 18657176 missense unknown
R6083:Muc16 UTSW 9 18657212 missense unknown
R6089:Muc16 UTSW 9 18643252 missense unknown
R6109:Muc16 UTSW 9 18655359 missense unknown
R6127:Muc16 UTSW 9 18657878 missense unknown
R6130:Muc16 UTSW 9 18590698 missense probably damaging 1.00
R6146:Muc16 UTSW 9 18497797 missense probably damaging 0.98
R6161:Muc16 UTSW 9 18647818 missense unknown
R6164:Muc16 UTSW 9 18558379 missense probably damaging 1.00
R6185:Muc16 UTSW 9 18654473 missense unknown
R6192:Muc16 UTSW 9 18658689 missense unknown
R6217:Muc16 UTSW 9 18655446 missense unknown
R6232:Muc16 UTSW 9 18656998 missense unknown
R6246:Muc16 UTSW 9 18577067 intron probably null
R6255:Muc16 UTSW 9 18655599 missense unknown
R6280:Muc16 UTSW 9 18579317 critical splice donor site probably null
R6286:Muc16 UTSW 9 18644389 missense unknown
R6287:Muc16 UTSW 9 18659034 missense unknown
R6307:Muc16 UTSW 9 18647588 missense unknown
R6310:Muc16 UTSW 9 18641950 missense probably benign 0.00
R6316:Muc16 UTSW 9 18641819 missense probably benign 0.01
R6335:Muc16 UTSW 9 18660708 missense unknown
R6345:Muc16 UTSW 9 18654926 missense unknown
R6349:Muc16 UTSW 9 18657329 missense unknown
R6366:Muc16 UTSW 9 18646044 missense unknown
R6393:Muc16 UTSW 9 18647399 nonsense probably null
R6440:Muc16 UTSW 9 18641359 missense probably benign 0.01
R6458:Muc16 UTSW 9 18641721 missense probably benign 0.01
R6460:Muc16 UTSW 9 18640516 missense probably benign 0.01
R6481:Muc16 UTSW 9 18550677 critical splice donor site probably null
R6539:Muc16 UTSW 9 18637325 missense probably benign 0.25
R6551:Muc16 UTSW 9 18562562 missense possibly damaging 0.95
R6596:Muc16 UTSW 9 18566715 missense probably benign 0.18
R6601:Muc16 UTSW 9 18637570 missense probably benign 0.10
R6602:Muc16 UTSW 9 18609476 intron probably null
R6615:Muc16 UTSW 9 18647188 missense unknown
R6625:Muc16 UTSW 9 18660278 missense unknown
R6668:Muc16 UTSW 9 18640385 missense probably benign 0.03
R6697:Muc16 UTSW 9 18641291 missense probably benign 0.01
R6710:Muc16 UTSW 9 18642070 missense possibly damaging 0.95
R6727:Muc16 UTSW 9 18566690 critical splice donor site probably null
R6789:Muc16 UTSW 9 18559986 missense probably benign 0.40
R6806:Muc16 UTSW 9 18537910 critical splice donor site probably null
R6874:Muc16 UTSW 9 18658769 nonsense probably null
R6894:Muc16 UTSW 9 18495576 missense possibly damaging 0.92
R6913:Muc16 UTSW 9 18642663 missense unknown
R6919:Muc16 UTSW 9 18660299 missense unknown
R6939:Muc16 UTSW 9 18638537 missense probably benign 0.04
R6953:Muc16 UTSW 9 18640529 missense probably benign 0.01
R6956:Muc16 UTSW 9 18645026 missense unknown
R6977:Muc16 UTSW 9 18645337 missense unknown
R6996:Muc16 UTSW 9 18645897 missense unknown
R7011:Muc16 UTSW 9 18637451 missense probably benign 0.26
R7011:Muc16 UTSW 9 18637543 missense probably benign 0.10
R7012:Muc16 UTSW 9 18495618 critical splice acceptor site probably null
R7014:Muc16 UTSW 9 18658236 missense unknown
R7021:Muc16 UTSW 9 18554919 missense unknown
R7021:Muc16 UTSW 9 18550831 splice site probably null
R7038:Muc16 UTSW 9 18620468 missense probably damaging 0.99
R7057:Muc16 UTSW 9 18646079 missense unknown
R7058:Muc16 UTSW 9 18639755 missense probably benign 0.10
R7066:Muc16 UTSW 9 18658021 missense unknown
R7067:Muc16 UTSW 9 18658251 missense unknown
R7070:Muc16 UTSW 9 18645923 nonsense probably null
R7074:Muc16 UTSW 9 18655650 missense unknown
R7085:Muc16 UTSW 9 18644849 missense unknown
R7088:Muc16 UTSW 9 18592680 missense probably damaging 0.99
R7107:Muc16 UTSW 9 18637298 missense probably benign 0.10
R7108:Muc16 UTSW 9 18655233 missense unknown
R7126:Muc16 UTSW 9 18641216 missense probably benign 0.01
R7128:Muc16 UTSW 9 18643004 missense unknown
R7145:Muc16 UTSW 9 18655580 missense unknown
R7179:Muc16 UTSW 9 18642008 missense probably benign 0.00
R7194:Muc16 UTSW 9 18674454 missense unknown
R7211:Muc16 UTSW 9 18498570 missense probably damaging 1.00
R7213:Muc16 UTSW 9 18641416 missense probably benign 0.01
R7217:Muc16 UTSW 9 18644076 nonsense probably null
R7221:Muc16 UTSW 9 18642199 missense probably benign 0.04
R7265:Muc16 UTSW 9 18656472 missense unknown
R7326:Muc16 UTSW 9 18585013 missense probably benign 0.03
R7359:Muc16 UTSW 9 18643020 missense unknown
R7387:Muc16 UTSW 9 18641720 missense probably benign 0.01
R7391:Muc16 UTSW 9 18639536 missense probably benign 0.04
R7398:Muc16 UTSW 9 18637742 missense possibly damaging 0.46
R7419:Muc16 UTSW 9 18641962 missense probably benign 0.01
R7431:Muc16 UTSW 9 18607993 missense
R7484:Muc16 UTSW 9 18646768 missense unknown
R7487:Muc16 UTSW 9 18584799 missense possibly damaging 0.93
R7497:Muc16 UTSW 9 18645089 missense unknown
R7515:Muc16 UTSW 9 18639662 missense probably benign 0.00
R7537:Muc16 UTSW 9 18638135 missense probably benign 0.06
R7538:Muc16 UTSW 9 18642131 missense probably benign 0.10
R7538:Muc16 UTSW 9 18655451 missense unknown
R7543:Muc16 UTSW 9 18644732 missense unknown
R7566:Muc16 UTSW 9 18638629 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGTGTAAATGTCTGTGTTCCACTG -3'
(R):5'- TCTTGCCAGATCAGAAGACACC -3'

Sequencing Primer
(F):5'- AGATCTTTGGAAGTTACCATGTTTG -3'
(R):5'- GATCAGAAGACACCACACTTTCATC -3'
Posted On2017-06-26