Incidental Mutation 'R5990:Ttll2'
ID481980
Institutional Source Beutler Lab
Gene Symbol Ttll2
Ensembl Gene ENSMUSG00000079722
Gene Nametubulin tyrosine ligase-like family, member 2
SynonymsEG625850
MMRRC Submission 044170-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.299) question?
Stock #R5990 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location7350885-7352696 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 7352367 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Tryptophan at position 54 (G54W)
Ref Sequence ENSEMBL: ENSMUSP00000111413 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115747] [ENSMUST00000231397]
Predicted Effect possibly damaging
Transcript: ENSMUST00000115747
AA Change: G54W

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000111413
Gene: ENSMUSG00000079722
AA Change: G54W

DomainStartEndE-ValueType
Pfam:TTL 91 383 1.2e-82 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000231397
Meta Mutation Damage Score 0.1016 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.2%
Validation Efficiency 99% (77/78)
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610028H24Rik A T 10: 76,449,289 M11L probably benign Het
Acad10 A G 5: 121,645,405 L319P probably damaging Het
Adam12 C A 7: 133,931,736 C471F probably damaging Het
Arfgef1 A G 1: 10,172,921 Y1065H probably damaging Het
Atp8b3 G A 10: 80,525,697 T797M possibly damaging Het
Auts2 G A 5: 131,476,895 probably benign Het
AW209491 C T 13: 14,637,780 A406V probably benign Het
Ccdc146 A G 5: 21,318,182 S286P probably benign Het
Chsy3 GT G 18: 59,176,166 probably null Het
Cmtr1 T C 17: 29,702,161 Y794H probably benign Het
Copb2 A G 9: 98,570,325 E54G probably damaging Het
Ctsk A T 3: 95,501,456 H77L probably damaging Het
Dnah3 T C 7: 120,073,541 Y546C probably benign Het
Ephb2 A T 4: 136,696,055 V304E probably benign Het
Ern1 C T 11: 106,411,769 V420I probably benign Het
Esrrg A T 1: 188,198,798 E339V probably damaging Het
Fbxo10 A C 4: 45,061,960 F189V probably damaging Het
Foxl1 G T 8: 121,128,421 A154S probably damaging Het
Frs3 A G 17: 47,701,677 D103G possibly damaging Het
Gdpd4 A G 7: 98,040,930 T610A probably benign Het
Gm10271 A T 10: 116,972,592 F6L probably damaging Het
Gm4847 C T 1: 166,643,373 S36N probably benign Het
Grm8 G T 6: 27,363,624 L631I probably damaging Het
Ints9 T A 14: 65,039,328 L648Q probably damaging Het
Kansl1l T C 1: 66,735,726 H647R probably damaging Het
Kcnq1 T A 7: 143,261,368 H501Q probably damaging Het
Kctd20 T C 17: 28,966,910 L409P probably benign Het
Kiss1r A G 10: 79,918,707 T12A probably benign Het
Kndc1 T A 7: 139,927,420 V1173E probably damaging Het
Kprp T C 3: 92,824,774 E323G probably damaging Het
Krtap10-4 A T 10: 77,826,607 probably benign Het
Lrrc37a A G 11: 103,500,958 Y1214H probably benign Het
Lysmd3 G A 13: 81,669,588 G228D probably damaging Het
Muc16 G A 9: 18,659,243 A660V unknown Het
Muc5b T C 7: 141,858,161 C1615R unknown Het
Nans A T 4: 46,489,441 N28I probably damaging Het
Nlrp4b C T 7: 10,714,491 S207L possibly damaging Het
Nrd1 T G 4: 109,019,071 F355V probably damaging Het
Nrip2 C T 6: 128,400,016 probably benign Het
Nufip1 C T 14: 76,114,188 P161L probably damaging Het
Ogdhl C T 14: 32,327,114 H114Y possibly damaging Het
Olfr1295 T A 2: 111,564,674 I257F probably damaging Het
Olfr160 G T 9: 37,712,110 H56Q probably damaging Het
Opa1 T A 16: 29,587,018 W134R probably damaging Het
Parp14 G A 16: 35,841,457 P1403S probably benign Het
Patl2 T C 2: 122,124,484 D361G probably damaging Het
Pcx A G 19: 4,621,266 D1172G probably damaging Het
Phax A G 18: 56,575,603 T58A probably benign Het
Phf11b T A 14: 59,324,926 I177L possibly damaging Het
Pole T A 5: 110,302,144 V819D probably damaging Het
Poll T C 19: 45,553,155 D458G possibly damaging Het
Polr2m G A 9: 71,479,320 probably null Het
Ppp1r9a C A 6: 5,134,660 H928N probably benign Het
Prdm2 T C 4: 143,170,113 N102D probably damaging Het
Rbm45 A T 2: 76,370,412 D95V probably benign Het
Rdh19 A G 10: 127,859,594 M226V probably benign Het
Rev3l T G 10: 39,823,811 S1435A probably benign Het
Rgs20 A G 1: 4,912,330 I305T probably benign Het
Rhobtb2 T C 14: 69,796,369 N469S probably damaging Het
Rif1 C G 2: 52,095,844 L614V probably damaging Het
Rps6ka1 A G 4: 133,866,397 I177T probably damaging Het
Samd12 T A 15: 53,719,623 D105V probably damaging Het
Setd3 A T 12: 108,160,335 D88E probably benign Het
Sfmbt2 G T 2: 10,579,381 V850L possibly damaging Het
Slc26a10 C A 10: 127,178,758 A195S possibly damaging Het
Smcp C A 3: 92,584,250 A97S unknown Het
Stxbp5 G A 10: 9,835,933 H248Y probably damaging Het
Syne2 T C 12: 76,024,144 L4457P probably benign Het
Tbx3 A G 5: 119,680,529 T390A probably benign Het
Tmeff2 G A 1: 50,979,442 W194* probably null Het
Tmem120b G A 5: 123,104,481 R174Q probably damaging Het
Trio A G 15: 27,891,459 V402A probably benign Het
Uba7 G A 9: 107,981,234 V786M probably damaging Het
Vmn2r32 T C 7: 7,479,810 E55G probably damaging Het
Wdr35 A G 12: 9,016,511 D724G probably damaging Het
Xrcc1 G A 7: 24,567,868 V381M probably damaging Het
Zdhhc11 T A 13: 73,979,184 W227R probably benign Het
Zfp341 T C 2: 154,645,659 S681P probably damaging Het
Zfp735 T A 11: 73,690,348 D70E possibly damaging Het
Zmat4 G A 8: 23,929,263 A104T probably damaging Het
Other mutations in Ttll2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02071:Ttll2 APN 17 7351731 missense probably damaging 1.00
IGL03190:Ttll2 APN 17 7351380 missense probably benign 0.05
R1922:Ttll2 UTSW 17 7352390 missense probably damaging 0.99
R2237:Ttll2 UTSW 17 7352123 missense probably benign 0.03
R2892:Ttll2 UTSW 17 7352699 unclassified probably null
R4388:Ttll2 UTSW 17 7351200 nonsense probably null
R4389:Ttll2 UTSW 17 7351200 nonsense probably null
R4534:Ttll2 UTSW 17 7351721 missense probably benign 0.02
R4535:Ttll2 UTSW 17 7351721 missense probably benign 0.02
R4536:Ttll2 UTSW 17 7351721 missense probably benign 0.02
R4868:Ttll2 UTSW 17 7351599 missense probably benign 0.07
R4870:Ttll2 UTSW 17 7351599 missense probably benign 0.07
R4871:Ttll2 UTSW 17 7351599 missense probably benign 0.07
R6145:Ttll2 UTSW 17 7351632 missense probably benign 0.08
R6332:Ttll2 UTSW 17 7351768 missense probably damaging 1.00
Z1088:Ttll2 UTSW 17 7351526 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGAGATTGGTCATCCCTGG -3'
(R):5'- GACAAATGTCAGGCCTAGGC -3'

Sequencing Primer
(F):5'- CCCTGGGTGATGGTTGAGCC -3'
(R):5'- GCGCACAGAAGCCGAAGC -3'
Posted On2017-06-26