Incidental Mutation 'R5991:Rnd2'
ID482023
Institutional Source Beutler Lab
Gene Symbol Rnd2
Ensembl Gene ENSMUSG00000001313
Gene NameRho family GTPase 2
SynonymsArhn, Rohn
MMRRC Submission 044171-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5991 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location101464999-101471853 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 101468999 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 57 (L57F)
Ref Sequence ENSEMBL: ENSMUSP00000001347 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001347] [ENSMUST00000040430]
Predicted Effect probably damaging
Transcript: ENSMUST00000001347
AA Change: L57F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000001347
Gene: ENSMUSG00000001313
AA Change: L57F

DomainStartEndE-ValueType
RHO 10 184 5.22e-100 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000040430
SMART Domains Protein: ENSMUSP00000048350
Gene: ENSMUSG00000034993

DomainStartEndE-ValueType
low complexity region 3 31 N/A INTRINSIC
low complexity region 41 60 N/A INTRINSIC
Pfam:ADH_N 89 157 8.8e-11 PFAM
Pfam:ADH_zinc_N 213 355 2.1e-21 PFAM
Pfam:ADH_zinc_N_2 245 398 6.9e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134980
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153185
Meta Mutation Damage Score 0.218 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.0%
  • 20x: 90.5%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Rho GTPase family, whose members play a key role in the regulation of actin cytoskeleton organization in response to extracellular growth factors. This particular family member has been implicated in the regulation of neuronal morphology and endosomal trafficking. The gene localizes to chromosome 17 and is the centromeric neighbor of the breast-ovarian cancer susceptibility gene BRCA1. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars G A 8: 111,050,400 R683Q probably damaging Het
Adam8 T A 7: 139,990,287 H69L probably damaging Het
Bbs2 G T 8: 94,098,286 R23S probably benign Het
Bod1l A T 5: 41,816,863 C2369* probably null Het
Capn11 G T 17: 45,659,352 probably null Het
Carmil2 A G 8: 105,691,391 Q679R probably null Het
Cep120 T C 18: 53,721,798 I422V probably benign Het
Cnot7 A C 8: 40,495,655 probably null Het
Col1a1 T C 11: 94,937,919 V29A unknown Het
Dnttip1 A T 2: 164,754,180 Q115L possibly damaging Het
Dyrk4 A G 6: 126,880,225 V497A probably benign Het
Ep300 A G 15: 81,648,466 D1635G unknown Het
Ercc5 T A 1: 44,180,830 C1087* probably null Het
Fap A T 2: 62,518,521 M517K probably damaging Het
Focad C A 4: 88,401,019 D1574E possibly damaging Het
Fsip2 C T 2: 82,990,468 P5515L probably benign Het
Gm9733 G T 3: 15,320,758 A28E probably benign Het
Gpr158 T C 2: 21,368,508 Y85H probably damaging Het
Hc A G 2: 35,006,105 V1222A possibly damaging Het
Hipk3 C T 2: 104,437,983 M546I probably damaging Het
Jup T C 11: 100,379,569 N371D possibly damaging Het
Ltbp4 A G 7: 27,309,316 Y1262H probably damaging Het
Lyar A G 5: 38,227,865 E83G probably damaging Het
Lyg2 C T 1: 37,915,719 probably null Het
Mtmr11 T A 3: 96,168,589 probably null Het
Myct1 A T 10: 5,604,426 R98* probably null Het
Nol11 T C 11: 107,171,145 T612A probably benign Het
Olfr1034 A G 2: 86,046,910 I143V probably benign Het
Olfr1218 C T 2: 89,054,782 V215I probably benign Het
Olfr1314 C T 2: 112,092,615 V29M probably benign Het
Olfr167 T C 16: 19,514,757 N293S probably damaging Het
Olfr32 T A 2: 90,138,234 K302* probably null Het
Parp14 G A 16: 35,841,457 P1403S probably benign Het
Pcdhb3 T C 18: 37,301,508 S176P probably benign Het
Pdcd1lg2 C T 19: 29,454,467 R212W probably benign Het
Plin3 T C 17: 56,286,576 Y46C probably damaging Het
Rfx7 G A 9: 72,619,538 E1337K possibly damaging Het
Ryr1 G T 7: 29,104,610 N584K probably damaging Het
Scmh1 T C 4: 120,522,620 V544A probably benign Het
Sdk2 G A 11: 113,943,254 T34M probably damaging Het
Serpinb9e T A 13: 33,259,807 L270H probably damaging Het
Shoc2 T A 19: 54,003,049 N248K probably damaging Het
Slc25a4 T C 8: 46,209,336 Y95C probably damaging Het
Slc4a1ap A G 5: 31,534,069 N403S possibly damaging Het
Spink10 T A 18: 62,657,885 W7R probably null Het
Ssrp1 A G 2: 85,042,296 K426R possibly damaging Het
Tbc1d24 G A 17: 24,209,069 probably benign Het
Tead3 A T 17: 28,334,378 probably null Het
Timd4 A G 11: 46,843,203 *344W probably null Het
Tmem181a T A 17: 6,289,037 W115R probably damaging Het
Tmem245 G A 4: 56,916,733 T65I probably damaging Het
Vmn1r12 G C 6: 57,159,655 V202L probably damaging Het
Vmn1r80 A G 7: 12,193,496 T178A probably benign Het
Vps33b T A 7: 80,283,414 probably null Het
Zmym6 T A 4: 127,108,473 probably null Het
Other mutations in Rnd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00596:Rnd2 APN 11 101471191 missense possibly damaging 0.81
IGL01964:Rnd2 APN 11 101470806 unclassified probably null
Atkins UTSW 11 101468999 missense probably damaging 1.00
R1581:Rnd2 UTSW 11 101471196 missense probably benign
R4606:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R4797:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R4824:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R4825:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R4931:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5005:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5078:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5079:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5402:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5405:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5497:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5498:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5501:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5534:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5619:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5666:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5669:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5670:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5671:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5786:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5788:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5844:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5845:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5857:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5989:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5992:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6018:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6019:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6020:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6122:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6144:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6148:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6208:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6209:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6226:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6230:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6332:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6333:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6335:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6491:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6541:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6605:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6606:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6607:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6677:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6678:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6726:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6796:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6797:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCAGACCAACTTCTGTCTAGGG -3'
(R):5'- AGACTTCCTACGTGGTTTCTG -3'

Sequencing Primer
(F):5'- ACCAACTTCTGTCTAGGGACTGAG -3'
(R):5'- GGTTTCTGTCAGGCCTAAGAAACTC -3'
Posted On2017-06-26