Incidental Mutation 'R6025:Dctn1'
ID482088
Institutional Source Beutler Lab
Gene Symbol Dctn1
Ensembl Gene ENSMUSG00000031865
Gene Namedynactin 1
Synonymsp150, Glued, p150
MMRRC Submission 044197-MU
Accession Numbers

Ncbi RefSeq: NM_007835.2, NM_001198866.1, NM_001198867.1; MGI: 107745

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6025 (G1)
Quality Score92.0077
Status Not validated
Chromosome6
Chromosomal Location83165920-83200117 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to A at 83193691 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000109552 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077407] [ENSMUST00000113907] [ENSMUST00000113913] [ENSMUST00000113918] [ENSMUST00000113919] [ENSMUST00000130212] [ENSMUST00000141680]
Predicted Effect probably null
Transcript: ENSMUST00000077407
SMART Domains Protein: ENSMUSP00000076623
Gene: ENSMUSG00000031865

DomainStartEndE-ValueType
CAP_GLY 12 78 5.52e-31 SMART
low complexity region 124 147 N/A INTRINSIC
low complexity region 148 177 N/A INTRINSIC
SCOP:d1fxkc_ 185 337 3e-3 SMART
low complexity region 363 379 N/A INTRINSIC
Pfam:Dynactin 489 768 8.2e-91 PFAM
low complexity region 800 820 N/A INTRINSIC
coiled coil region 914 1009 N/A INTRINSIC
low complexity region 1025 1043 N/A INTRINSIC
coiled coil region 1143 1172 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000113907
SMART Domains Protein: ENSMUSP00000109540
Gene: ENSMUSG00000031865

DomainStartEndE-ValueType
low complexity region 5 22 N/A INTRINSIC
low complexity region 27 50 N/A INTRINSIC
low complexity region 51 80 N/A INTRINSIC
low complexity region 93 106 N/A INTRINSIC
low complexity region 140 158 N/A INTRINSIC
SCOP:d1lxa__ 271 345 8e-3 SMART
Pfam:Dynactin 392 671 7.1e-91 PFAM
low complexity region 703 723 N/A INTRINSIC
coiled coil region 817 912 N/A INTRINSIC
low complexity region 928 946 N/A INTRINSIC
coiled coil region 1046 1075 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000113913
SMART Domains Protein: ENSMUSP00000109546
Gene: ENSMUSG00000031865

DomainStartEndE-ValueType
CAP_GLY 12 78 5.52e-31 SMART
low complexity region 118 139 N/A INTRINSIC
low complexity region 144 167 N/A INTRINSIC
low complexity region 168 197 N/A INTRINSIC
SCOP:d1fxkc_ 205 357 3e-3 SMART
low complexity region 383 399 N/A INTRINSIC
Pfam:Dynactin 509 788 2.5e-90 PFAM
low complexity region 820 840 N/A INTRINSIC
coiled coil region 934 1029 N/A INTRINSIC
low complexity region 1051 1069 N/A INTRINSIC
coiled coil region 1168 1197 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000113918
SMART Domains Protein: ENSMUSP00000109551
Gene: ENSMUSG00000031865

DomainStartEndE-ValueType
CAP_GLY 29 95 5.52e-31 SMART
low complexity region 135 156 N/A INTRINSIC
low complexity region 161 184 N/A INTRINSIC
low complexity region 185 214 N/A INTRINSIC
low complexity region 227 240 N/A INTRINSIC
low complexity region 274 292 N/A INTRINSIC
low complexity region 400 416 N/A INTRINSIC
Pfam:Dynactin 526 805 3.3e-90 PFAM
low complexity region 837 857 N/A INTRINSIC
coiled coil region 951 1046 N/A INTRINSIC
coiled coil region 1147 1176 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000113919
SMART Domains Protein: ENSMUSP00000109552
Gene: ENSMUSG00000031865

DomainStartEndE-ValueType
CAP_GLY 29 95 5.52e-31 SMART
low complexity region 135 156 N/A INTRINSIC
low complexity region 161 184 N/A INTRINSIC
low complexity region 185 214 N/A INTRINSIC
SCOP:d1fxkc_ 222 374 3e-3 SMART
low complexity region 400 416 N/A INTRINSIC
Pfam:Dynactin 522 805 1.4e-103 PFAM
low complexity region 837 857 N/A INTRINSIC
coiled coil region 951 1046 N/A INTRINSIC
low complexity region 1068 1086 N/A INTRINSIC
coiled coil region 1185 1214 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123313
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127824
Predicted Effect probably benign
Transcript: ENSMUST00000130212
SMART Domains Protein: ENSMUSP00000115838
Gene: ENSMUSG00000031865

DomainStartEndE-ValueType
CAP_GLY 12 78 5.52e-31 SMART
low complexity region 124 147 N/A INTRINSIC
low complexity region 148 177 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130917
Predicted Effect probably benign
Transcript: ENSMUST00000141680
SMART Domains Protein: ENSMUSP00000121538
Gene: ENSMUSG00000031865

DomainStartEndE-ValueType
CAP_GLY 12 78 5.52e-31 SMART
low complexity region 118 139 N/A INTRINSIC
low complexity region 144 159 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153793
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154420
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype Strain: 3769512
Lethality: E8-E10
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the largest subunit of dynactin, a macromolecular complex consisting of 10 subunits ranging in size from 22 to 150 kD. Dynactin binds to both microtubules and cytoplasmic dynein. Dynactin is involved in a diverse array of cellular functions, including ER-to-Golgi transport, the centripetal movement of lysosomes and endosomes, spindle formation, chromosome movement, nuclear positioning, and axonogenesis. This subunit interacts with dynein intermediate chain by its domains directly binding to dynein and binds to microtubules via a highly conserved glycine-rich cytoskeleton-associated protein (CAP-Gly) domain in its N-terminus. Alternative splicing of this gene results in multiple transcript variants encoding distinct isoforms. Mutations in this gene cause distal hereditary motor neuronopathy type VIIB (HMN7B) which is also known as distal spinal and bulbar muscular atrophy (dSBMA). [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality and developmental arrest at E7.5 associated with increased apoptosis. [provided by MGI curators]
Allele List at MGI

All alleles(20) : Targeted(4) Gene trapped(16)

Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310033P09Rik GC G 11: 59,210,313 probably null Het
Acvr1b C A 15: 101,194,975 D166E probably benign Het
Adgra2 T C 8: 27,114,463 I522T probably damaging Het
Adgre4 C T 17: 55,792,013 S173L probably benign Het
Akap9 A T 5: 4,032,801 Q1975L probably damaging Het
Ap3d1 T A 10: 80,710,464 M965L probably benign Het
Brca2 CATA CA 5: 150,541,575 probably null Het
Chd6 T C 2: 160,965,582 N1904S probably benign Het
Clstn3 A T 6: 124,431,664 S896R possibly damaging Het
Col6a3 T A 1: 90,828,102 D155V probably damaging Het
Dct T C 14: 118,036,464 T344A possibly damaging Het
Dgkz T C 2: 91,945,910 T3A possibly damaging Het
Duoxa2 T C 2: 122,301,851 S249P possibly damaging Het
Ehbp1 A T 11: 22,239,156 V82E probably damaging Het
Fam71e2 T A 7: 4,758,144 D523V probably benign Het
Fcho1 A T 8: 71,712,573 probably null Het
Ifi213 T A 1: 173,595,234 N22Y probably damaging Het
Kcnq1 T A 7: 143,106,433 probably benign Het
Kif7 T A 7: 79,704,640 Q799L probably benign Het
Lmnb1 T A 18: 56,729,384 L206* probably null Het
Lonp2 G T 8: 86,713,373 G247V probably damaging Het
Ly75 T C 2: 60,375,962 Y121C probably damaging Het
Mboat1 C A 13: 30,224,526 T224K probably benign Het
Mcm9 T C 10: 53,615,977 E416G possibly damaging Het
Mtnr1b A T 9: 15,862,797 I322N probably damaging Het
Nanog G A 6: 122,713,391 G227R possibly damaging Het
Nbn T C 4: 15,981,347 S480P probably damaging Het
Nek10 C A 14: 14,865,633 L638M probably benign Het
Nelfcd T C 2: 174,426,818 V538A probably damaging Het
Olfr124 T G 17: 37,805,421 I92S probably damaging Het
Olfr1447 T A 19: 12,901,670 T37S probably benign Het
Olfr393 A T 11: 73,847,919 S69T probably benign Het
Olfr69 T C 7: 103,768,209 I63V probably benign Het
Phf24 G A 4: 42,938,780 probably null Het
Pigz T C 16: 31,945,710 S529P probably damaging Het
Pik3r5 A G 11: 68,492,318 E321G probably damaging Het
Plcb3 G A 19: 6,956,179 T926I probably benign Het
Pm20d2 G A 4: 33,181,833 P257S probably damaging Het
Pon2 A G 6: 5,289,057 V34A probably benign Het
Prkar2b A G 12: 32,060,856 F76S possibly damaging Het
Prpf31 G A 7: 3,639,669 E414K probably benign Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Het
Setbp1 A T 18: 78,859,240 L404Q probably damaging Het
Slc26a11 C T 11: 119,374,828 A389V probably damaging Het
Slc2a1 A T 4: 119,136,342 T459S possibly damaging Het
Spi1 T C 2: 91,114,340 L135P probably benign Het
Sspo T C 6: 48,486,786 L3844P possibly damaging Het
Stxbp5 T A 10: 9,800,028 T616S probably benign Het
Syde2 A G 3: 146,007,141 probably null Het
Synm G T 7: 67,734,938 A550D possibly damaging Het
Tanc2 G A 11: 105,867,717 R768Q probably damaging Het
Tanc2 T C 11: 105,896,547 V891A possibly damaging Het
Tlx1 A T 19: 45,155,974 Q45L probably damaging Het
Tmem104 C A 11: 115,205,523 Y191* probably null Het
Tmem17 A C 11: 22,518,659 *199C probably null Het
Tns3 A T 11: 8,492,578 M595K possibly damaging Het
Tyk2 A G 9: 21,115,960 V538A probably benign Het
Unc80 A G 1: 66,695,568 D3250G possibly damaging Het
Usp4 A G 9: 108,360,123 H130R possibly damaging Het
Zfhx2 T C 14: 55,065,208 Q1773R probably benign Het
Zfp790 A G 7: 29,829,545 K552E possibly damaging Het
Zswim5 G A 4: 116,950,909 R230Q probably damaging Het
Other mutations in Dctn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01113:Dctn1 APN 6 83179897 missense probably benign 0.00
IGL01450:Dctn1 APN 6 83194110 unclassified probably benign
IGL01876:Dctn1 APN 6 83197921 missense probably damaging 1.00
IGL01958:Dctn1 APN 6 83191344 missense possibly damaging 0.95
IGL02554:Dctn1 APN 6 83182722 missense probably damaging 1.00
IGL02668:Dctn1 APN 6 83191048 missense possibly damaging 0.89
IGL02814:Dctn1 APN 6 83189914 missense probably damaging 1.00
IGL02818:Dctn1 APN 6 83192514 missense possibly damaging 0.86
IGL03007:Dctn1 APN 6 83182708 missense probably damaging 1.00
IGL03065:Dctn1 APN 6 83192493 missense probably damaging 0.99
IGL03083:Dctn1 APN 6 83197484 splice site probably benign
IGL03394:Dctn1 APN 6 83191284 missense possibly damaging 0.61
E0374:Dctn1 UTSW 6 83194174 missense possibly damaging 0.93
IGL03014:Dctn1 UTSW 6 83197369 intron probably benign
PIT4812001:Dctn1 UTSW 6 83199762 missense possibly damaging 0.86
R0044:Dctn1 UTSW 6 83191134 missense probably damaging 1.00
R0047:Dctn1 UTSW 6 83182632 nonsense probably null
R0047:Dctn1 UTSW 6 83182632 nonsense probably null
R0057:Dctn1 UTSW 6 83179892 missense probably benign 0.14
R0731:Dctn1 UTSW 6 83183089 missense probably damaging 0.98
R0738:Dctn1 UTSW 6 83190107 critical splice donor site probably null
R0755:Dctn1 UTSW 6 83189077 missense probably damaging 0.96
R0839:Dctn1 UTSW 6 83190477 missense possibly damaging 0.53
R1035:Dctn1 UTSW 6 83190220 missense probably damaging 1.00
R1454:Dctn1 UTSW 6 83197508 missense possibly damaging 0.93
R1469:Dctn1 UTSW 6 83192889 missense probably damaging 1.00
R1469:Dctn1 UTSW 6 83192889 missense probably damaging 1.00
R1627:Dctn1 UTSW 6 83195082 missense probably damaging 0.99
R1631:Dctn1 UTSW 6 83197596 missense possibly damaging 0.56
R1812:Dctn1 UTSW 6 83192518 missense possibly damaging 0.85
R1928:Dctn1 UTSW 6 83199184 splice site probably benign
R2008:Dctn1 UTSW 6 83189956 missense probably damaging 0.99
R2242:Dctn1 UTSW 6 83199705 missense probably damaging 0.99
R2259:Dctn1 UTSW 6 83197586 missense possibly damaging 0.46
R2422:Dctn1 UTSW 6 83199800 missense possibly damaging 0.92
R2483:Dctn1 UTSW 6 83194187 missense probably damaging 1.00
R4455:Dctn1 UTSW 6 83195049 missense probably damaging 1.00
R4724:Dctn1 UTSW 6 83189938 missense possibly damaging 0.53
R4812:Dctn1 UTSW 6 83189937 missense probably benign 0.24
R4819:Dctn1 UTSW 6 83190519 missense probably damaging 0.97
R4831:Dctn1 UTSW 6 83199771 missense possibly damaging 0.46
R4928:Dctn1 UTSW 6 83189207 missense possibly damaging 0.73
R5087:Dctn1 UTSW 6 83191639 missense probably damaging 1.00
R5354:Dctn1 UTSW 6 83183126 missense possibly damaging 0.93
R5372:Dctn1 UTSW 6 83190210 missense probably damaging 0.96
R5493:Dctn1 UTSW 6 83182564 missense possibly damaging 0.89
R5494:Dctn1 UTSW 6 83182564 missense possibly damaging 0.89
R5732:Dctn1 UTSW 6 83197949 critical splice donor site probably null
R5856:Dctn1 UTSW 6 83197865 missense probably damaging 1.00
R6999:Dctn1 UTSW 6 83191281 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- ACCGCTGAGCTATCATTGGC -3'
(R):5'- TGACTGTCACATGCGCATG -3'

Sequencing Primer
(F):5'- AGACGGCATCTTACTGTAGC -3'
(R):5'- TCACATGCGCATGGGTCCTC -3'
Posted On2017-06-27