Incidental Mutation 'R6029:Snap91'
ID482096
Institutional Source Beutler Lab
Gene Symbol Snap91
Ensembl Gene ENSMUSG00000033419
Gene Namesynaptosomal-associated protein 91
SynonymsF1-20, AP180, 91kDa
MMRRC Submission 044201-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.881) question?
Stock #R6029 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location86765923-86880654 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 86825080 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000096096 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036347] [ENSMUST00000036347] [ENSMUST00000074468] [ENSMUST00000074468] [ENSMUST00000074501] [ENSMUST00000098495]
Predicted Effect probably null
Transcript: ENSMUST00000036347
SMART Domains Protein: ENSMUSP00000046189
Gene: ENSMUSG00000033419

DomainStartEndE-ValueType
ENTH 20 145 8.41e-48 SMART
low complexity region 334 347 N/A INTRINSIC
low complexity region 357 374 N/A INTRINSIC
low complexity region 403 433 N/A INTRINSIC
low complexity region 439 466 N/A INTRINSIC
low complexity region 477 488 N/A INTRINSIC
low complexity region 499 558 N/A INTRINSIC
internal_repeat_1 559 586 3.27e-5 PROSPERO
internal_repeat_1 584 611 3.27e-5 PROSPERO
low complexity region 616 634 N/A INTRINSIC
low complexity region 652 669 N/A INTRINSIC
low complexity region 699 716 N/A INTRINSIC
low complexity region 728 757 N/A INTRINSIC
low complexity region 802 814 N/A INTRINSIC
low complexity region 850 862 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000036347
SMART Domains Protein: ENSMUSP00000046189
Gene: ENSMUSG00000033419

DomainStartEndE-ValueType
ENTH 20 145 8.41e-48 SMART
low complexity region 334 347 N/A INTRINSIC
low complexity region 357 374 N/A INTRINSIC
low complexity region 403 433 N/A INTRINSIC
low complexity region 439 466 N/A INTRINSIC
low complexity region 477 488 N/A INTRINSIC
low complexity region 499 558 N/A INTRINSIC
internal_repeat_1 559 586 3.27e-5 PROSPERO
internal_repeat_1 584 611 3.27e-5 PROSPERO
low complexity region 616 634 N/A INTRINSIC
low complexity region 652 669 N/A INTRINSIC
low complexity region 699 716 N/A INTRINSIC
low complexity region 728 757 N/A INTRINSIC
low complexity region 802 814 N/A INTRINSIC
low complexity region 850 862 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000074468
SMART Domains Protein: ENSMUSP00000074066
Gene: ENSMUSG00000033419

DomainStartEndE-ValueType
ENTH 20 145 8.41e-48 SMART
low complexity region 334 347 N/A INTRINSIC
low complexity region 357 374 N/A INTRINSIC
low complexity region 403 433 N/A INTRINSIC
low complexity region 439 466 N/A INTRINSIC
low complexity region 477 488 N/A INTRINSIC
low complexity region 499 558 N/A INTRINSIC
internal_repeat_1 559 586 6.86e-5 PROSPERO
internal_repeat_1 584 611 6.86e-5 PROSPERO
low complexity region 616 634 N/A INTRINSIC
low complexity region 652 669 N/A INTRINSIC
low complexity region 702 717 N/A INTRINSIC
low complexity region 733 762 N/A INTRINSIC
low complexity region 833 847 N/A INTRINSIC
low complexity region 883 895 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000074468
SMART Domains Protein: ENSMUSP00000074066
Gene: ENSMUSG00000033419

DomainStartEndE-ValueType
ENTH 20 145 8.41e-48 SMART
low complexity region 334 347 N/A INTRINSIC
low complexity region 357 374 N/A INTRINSIC
low complexity region 403 433 N/A INTRINSIC
low complexity region 439 466 N/A INTRINSIC
low complexity region 477 488 N/A INTRINSIC
low complexity region 499 558 N/A INTRINSIC
internal_repeat_1 559 586 6.86e-5 PROSPERO
internal_repeat_1 584 611 6.86e-5 PROSPERO
low complexity region 616 634 N/A INTRINSIC
low complexity region 652 669 N/A INTRINSIC
low complexity region 702 717 N/A INTRINSIC
low complexity region 733 762 N/A INTRINSIC
low complexity region 833 847 N/A INTRINSIC
low complexity region 883 895 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000074501
SMART Domains Protein: ENSMUSP00000074095
Gene: ENSMUSG00000033419

DomainStartEndE-ValueType
ENTH 20 145 8.41e-48 SMART
low complexity region 332 345 N/A INTRINSIC
low complexity region 355 382 N/A INTRINSIC
low complexity region 409 424 N/A INTRINSIC
low complexity region 440 469 N/A INTRINSIC
low complexity region 540 554 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000098495
SMART Domains Protein: ENSMUSP00000096096
Gene: ENSMUSG00000033419

DomainStartEndE-ValueType
ENTH 20 145 8.41e-48 SMART
low complexity region 332 345 N/A INTRINSIC
low complexity region 355 372 N/A INTRINSIC
low complexity region 396 426 N/A INTRINSIC
low complexity region 432 459 N/A INTRINSIC
low complexity region 470 481 N/A INTRINSIC
low complexity region 492 551 N/A INTRINSIC
internal_repeat_1 552 579 4.67e-5 PROSPERO
internal_repeat_1 577 604 4.67e-5 PROSPERO
low complexity region 609 627 N/A INTRINSIC
low complexity region 667 682 N/A INTRINSIC
low complexity region 698 727 N/A INTRINSIC
low complexity region 772 784 N/A INTRINSIC
low complexity region 820 832 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167014
SMART Domains Protein: ENSMUSP00000128738
Gene: ENSMUSG00000033419

DomainStartEndE-ValueType
ENTH 20 145 8.41e-48 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189762
Meta Mutation Damage Score 0.6068 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.7%
Validation Efficiency 97% (87/90)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele display postnatal growth retardation, limb clasping, altered behavior, defects in synaptic vesicle reformation, impaired neurotransmission, excitatory/inhibitory imbalance, epileptic seizures, and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik G A 2: 68,694,026 probably null Het
4933402N22Rik A T 5: 11,920,713 L84F probably damaging Het
9930021J03Rik A G 19: 29,754,967 probably benign Het
Adi1 G A 12: 28,679,319 probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Apob A G 12: 8,016,243 E4371G probably damaging Het
Ash1l T C 3: 88,985,019 Y1402H probably damaging Het
Aspm T G 1: 139,480,990 C2538W possibly damaging Het
Btbd16 T C 7: 130,819,072 V353A probably benign Het
Cad C T 5: 31,054,983 S10L possibly damaging Het
Cdc42bpa T C 1: 180,111,787 S877P probably damaging Het
Cep152 A T 2: 125,563,632 V1660D probably benign Het
Clrn2 G T 5: 45,460,186 G133V probably damaging Het
Clstn2 T C 9: 97,456,581 I842V probably benign Het
Cpt1c C T 7: 44,965,124 A434T probably benign Het
D130052B06Rik G T 11: 33,623,477 V70L possibly damaging Het
Dlg1 T A 16: 31,793,570 V317E probably damaging Het
Dock10 T C 1: 80,536,946 E1084G possibly damaging Het
Dync2h1 A G 9: 7,157,646 V827A probably benign Het
E030030I06Rik A G 10: 22,148,933 L27P unknown Het
Ero1lb T A 13: 12,574,833 L39Q probably damaging Het
Erp27 T C 6: 136,911,611 D123G probably damaging Het
Fasn G T 11: 120,820,909 F148L probably damaging Het
Fbxl5 T C 5: 43,765,404 E218G probably damaging Het
Fbxw28 A T 9: 109,329,425 D210E probably damaging Het
Gm10653 T A 9: 62,841,514 probably benign Het
Gm17067 A G 7: 42,708,130 L316S probably benign Het
Gm29106 T C 1: 118,200,260 S561P probably damaging Het
H2afy2 T C 10: 61,747,762 T200A possibly damaging Het
Hmcn1 C A 1: 150,632,437 K3699N probably benign Het
Itch T A 2: 155,179,089 probably null Het
Itpr3 C T 17: 27,098,171 A800V probably damaging Het
Kdm2b A T 5: 122,879,587 M1052K probably damaging Het
Kdm4b T C 17: 56,396,576 M712T probably damaging Het
Kmt5b A G 19: 3,802,104 E137G probably damaging Het
Krt33a G A 11: 100,012,463 T251I probably benign Het
Lrrc4b G T 7: 44,462,330 R542L probably benign Het
Macf1 C A 4: 123,507,333 S653I probably damaging Het
Macrod2 G A 2: 142,318,447 V408M probably damaging Het
Mapkapk3 G T 9: 107,289,226 A40E possibly damaging Het
Mmp20 G A 9: 7,639,301 V157I probably benign Het
Mrps28 T C 3: 8,923,745 R18G possibly damaging Het
Msrb2 T A 2: 19,394,311 C162S probably damaging Het
Nat6 A G 9: 107,583,554 Y216C probably damaging Het
Nckap5 T G 1: 126,025,786 T1078P possibly damaging Het
Nectin3 T C 16: 46,436,400 Y91C probably benign Het
Nf2 G T 11: 4,784,566 probably null Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1209 T C 2: 88,910,036 D119G probably damaging Het
Olfr1288 T A 2: 111,478,965 Y60* probably null Het
Olfr1380 A T 11: 49,564,601 I227F possibly damaging Het
Olfr149 G A 9: 39,702,400 A123V probably damaging Het
Olfr537-ps1 A T 7: 140,538,876 M120L unknown Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Oxr1 T G 15: 41,825,901 L507W probably damaging Het
Plxna2 A G 1: 194,794,427 M1184V probably benign Het
Plxna2 A T 1: 194,799,575 K1451M probably damaging Het
Pofut1 G A 2: 153,259,793 probably null Het
Ppp1r16b T C 2: 158,755,217 V257A possibly damaging Het
Prss56 G A 1: 87,187,557 W498* probably null Het
Ptpru A G 4: 131,771,293 F1329S probably damaging Het
Pusl1 A G 4: 155,889,463 F278S probably damaging Het
Qars A T 9: 108,513,690 L470F probably damaging Het
Rbm8a2 T C 1: 175,978,746 D55G probably benign Het
Rora T A 9: 69,364,452 N181K probably benign Het
Rufy3 A G 5: 88,627,255 D262G probably damaging Het
Sh3gl2 G A 4: 85,381,414 V212M probably damaging Het
Sis G A 3: 72,928,308 T907I probably benign Het
Slc38a3 A T 9: 107,652,175 I456N probably damaging Het
Slc4a8 T A 15: 100,807,339 C809S probably benign Het
Spaca6 A G 17: 17,831,196 T45A probably benign Het
Spry1 T C 3: 37,642,848 I80T possibly damaging Het
St8sia2 A G 7: 73,960,710 L275P possibly damaging Het
Supt7l C A 5: 31,526,987 probably null Het
Tdo2 T A 3: 81,961,440 K304N probably damaging Het
Tdrd12 A T 7: 35,485,230 Y753N probably damaging Het
Topbp1 A T 9: 103,344,953 Q1341L probably benign Het
Trim14 G T 4: 46,506,998 A406E probably benign Het
Trp63 C T 16: 25,868,214 R393W probably damaging Het
Trrap T C 5: 144,817,679 V1932A possibly damaging Het
Trrap T C 5: 144,825,914 M2399T possibly damaging Het
Unc45b A G 11: 82,913,327 N110S probably damaging Het
Usp32 G T 11: 85,025,582 H845Q probably damaging Het
Usp44 G A 10: 93,846,632 D268N probably damaging Het
Vmn1r18 T G 6: 57,390,466 R34S possibly damaging Het
Vmn2r103 T A 17: 19,794,216 Y423* probably null Het
Wapl A T 14: 34,739,247 E1054V possibly damaging Het
Zbtb8b A G 4: 129,428,493 Y392H probably damaging Het
Zdhhc2 A T 8: 40,472,927 Q321L probably null Het
Zfp983 A G 17: 21,662,485 D443G probably benign Het
Other mutations in Snap91
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00985:Snap91 APN 9 86821737 missense probably benign 0.01
IGL01147:Snap91 APN 9 86798558 missense probably benign 0.37
IGL01358:Snap91 APN 9 86806560 missense probably damaging 1.00
IGL01501:Snap91 APN 9 86838125 missense probably damaging 0.99
IGL01883:Snap91 APN 9 86775612 missense probably damaging 1.00
IGL02632:Snap91 APN 9 86839522 missense possibly damaging 0.94
IGL02864:Snap91 APN 9 86838088 missense possibly damaging 0.95
IGL03276:Snap91 APN 9 86825012 missense possibly damaging 0.78
PIT4514001:Snap91 UTSW 9 86879433 missense possibly damaging 0.86
R1564:Snap91 UTSW 9 86792196 missense possibly damaging 0.85
R1804:Snap91 UTSW 9 86783417 missense probably benign 0.01
R1840:Snap91 UTSW 9 86815465 missense probably damaging 1.00
R1869:Snap91 UTSW 9 86790141 critical splice acceptor site probably null
R2156:Snap91 UTSW 9 86825077 missense probably damaging 1.00
R2221:Snap91 UTSW 9 86792527 missense possibly damaging 0.53
R2223:Snap91 UTSW 9 86792527 missense possibly damaging 0.53
R2233:Snap91 UTSW 9 86798571 missense probably benign 0.23
R2680:Snap91 UTSW 9 86879550 start codon destroyed probably null 1.00
R3077:Snap91 UTSW 9 86838854 missense possibly damaging 0.95
R3702:Snap91 UTSW 9 86806520 missense probably damaging 0.99
R3840:Snap91 UTSW 9 86839565 missense probably damaging 1.00
R3912:Snap91 UTSW 9 86792557 missense possibly damaging 0.53
R3913:Snap91 UTSW 9 86792557 missense possibly damaging 0.53
R3958:Snap91 UTSW 9 86838130 missense probably damaging 1.00
R3963:Snap91 UTSW 9 86775612 missense probably damaging 1.00
R4043:Snap91 UTSW 9 86777049 missense probably damaging 1.00
R4133:Snap91 UTSW 9 86777049 missense probably damaging 1.00
R4641:Snap91 UTSW 9 86879475 missense probably damaging 1.00
R4674:Snap91 UTSW 9 86792017 missense possibly damaging 0.73
R4770:Snap91 UTSW 9 86773601 missense possibly damaging 0.86
R4798:Snap91 UTSW 9 86783454 intron probably benign
R4849:Snap91 UTSW 9 86792560 missense possibly damaging 0.53
R4991:Snap91 UTSW 9 86790154 splice site probably null
R5200:Snap91 UTSW 9 86815444 missense probably damaging 1.00
R5354:Snap91 UTSW 9 86835124 missense possibly damaging 0.84
R5644:Snap91 UTSW 9 86790153 splice site probably null
R6091:Snap91 UTSW 9 86839628 missense probably damaging 1.00
R6175:Snap91 UTSW 9 86825000 missense probably damaging 1.00
R6191:Snap91 UTSW 9 86838052 missense probably damaging 1.00
R6611:Snap91 UTSW 9 86790127 missense probably benign 0.33
R6764:Snap91 UTSW 9 86792181 missense probably benign 0.33
R6881:Snap91 UTSW 9 86773593 missense possibly damaging 0.73
R7201:Snap91 UTSW 9 86790146 splice site probably null
R7223:Snap91 UTSW 9 86879557 start gained probably benign
R7247:Snap91 UTSW 9 86792616 missense unknown
R7327:Snap91 UTSW 9 86773545 missense unknown
R7520:Snap91 UTSW 9 86839649 missense probably damaging 1.00
X0027:Snap91 UTSW 9 86798828 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CATGCTAACACATCCTGGGC -3'
(R):5'- TTTCAGTGAGACAGATGAACGG -3'

Sequencing Primer
(F):5'- TAACACATCCTGGGCATGTG -3'
(R):5'- GGCGCCATTCTGAGATGAAC -3'
Posted On2017-06-27