Incidental Mutation 'R0517:Setx'
ID48210
Institutional Source Beutler Lab
Gene Symbol Setx
Ensembl Gene ENSMUSG00000043535
Gene Namesenataxin
SynonymsA930037J23Rik, Als4
MMRRC Submission 038710-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0517 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location29124181-29182471 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 29157133 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 1874 (S1874R)
Ref Sequence ENSEMBL: ENSMUSP00000051492 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061578]
Predicted Effect probably benign
Transcript: ENSMUST00000061578
AA Change: S1874R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000051492
Gene: ENSMUSG00000043535
AA Change: S1874R

DomainStartEndE-ValueType
low complexity region 864 876 N/A INTRINSIC
low complexity region 1002 1020 N/A INTRINSIC
low complexity region 1058 1079 N/A INTRINSIC
low complexity region 1575 1594 N/A INTRINSIC
Pfam:AAA_11 1909 2194 1.9e-68 PFAM
Pfam:AAA_19 1924 2015 2.9e-11 PFAM
Pfam:AAA_12 2201 2402 1.1e-54 PFAM
low complexity region 2499 2516 N/A INTRINSIC
low complexity region 2576 2587 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135992
Meta Mutation Damage Score 0.184 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 92.1%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein named for its homology to the Sen1p protein of fungi which has RNA helicase activity encoded by a domain at the C-terminal end of the protein. The protein encoded by this gene contains a DNA/RNA helicase domain at its C-terminal end which suggests that it may be involved in both DNA and RNA processing. Mutations in this gene have been associated with ataxia-ocular apraxia-2 (AOA2) and an autosomal dominant form of juvenile amyotrophic lateral sclerosis (ALS4). [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit male infertility due to arrested male meiosis and reduced female fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410137M14Rik T A 17: 36,981,132 probably benign Het
Acer1 T C 17: 56,955,569 T194A probably benign Het
Adamts1 C A 16: 85,800,353 D10Y possibly damaging Het
Adamts7 T C 9: 90,199,858 V1612A probably benign Het
Adcyap1r1 T A 6: 55,491,297 S373T probably damaging Het
Armc4 A C 18: 7,223,621 L474R probably damaging Het
Asic5 A T 3: 82,009,526 I266F probably benign Het
Cacna1d A T 14: 30,179,275 I274K probably damaging Het
Camsap2 G T 1: 136,293,388 Q238K possibly damaging Het
Ceacam15 A C 7: 16,673,520 L24* probably null Het
Cerk G A 15: 86,156,648 T170I probably damaging Het
Cyp27b1 T C 10: 127,050,116 probably null Het
Cyp2c65 T C 19: 39,082,348 probably benign Het
Dennd5a A G 7: 109,934,761 S75P probably damaging Het
Dhx9 C T 1: 153,478,916 A146T possibly damaging Het
Dpysl5 A G 5: 30,778,066 D171G probably damaging Het
Dsg3 A G 18: 20,529,025 N449S probably benign Het
Eps8l3 T C 3: 107,883,460 S189P probably benign Het
Exph5 A G 9: 53,372,762 E381G probably benign Het
Fam208b T A 13: 3,566,964 T2367S possibly damaging Het
Fbxo46 A G 7: 19,136,874 M473V possibly damaging Het
Fgf14 G A 14: 123,983,784 P203S probably damaging Het
Foxf2 C T 13: 31,626,243 A55V unknown Het
Galnt5 T G 2: 58,035,373 probably benign Het
Glis2 T C 16: 4,611,552 L181P probably damaging Het
Gm1000 T G 12: 104,476,408 probably benign Het
Helz2 A G 2: 181,227,770 S2959P probably benign Het
Hyal6 A G 6: 24,734,853 N262D probably benign Het
Lgr4 T C 2: 110,011,320 L526P probably damaging Het
Mapk1 A T 16: 17,016,046 I88F probably benign Het
Mpg A T 11: 32,231,853 H287L probably benign Het
Mpp4 A T 1: 59,124,727 Y489* probably null Het
Mpzl1 T C 1: 165,601,790 E224G probably damaging Het
Myh10 A G 11: 68,811,599 probably null Het
Olfr1034 T C 2: 86,047,204 S241P probably damaging Het
Olfr1340 T A 4: 118,726,634 I129K probably damaging Het
Paip1 T A 13: 119,447,790 F196I probably damaging Het
Pde3a A T 6: 141,498,657 K1064* probably null Het
Pira2 A T 7: 3,844,197 probably benign Het
Pros1 A G 16: 62,903,518 S210G probably benign Het
Rbm15 A T 3: 107,331,369 L571Q probably damaging Het
Scn1a T A 2: 66,302,407 T1194S possibly damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Serpina1e G A 12: 103,949,227 T240I probably benign Het
Sgsm2 G T 11: 74,867,651 T256K possibly damaging Het
Slc44a1 T C 4: 53,542,366 V300A probably damaging Het
Spata46 A G 1: 170,311,609 Y59C probably damaging Het
Supt3 T C 17: 45,119,271 F404L probably benign Het
Tars T A 15: 11,394,366 K62* probably null Het
Tas2r139 A C 6: 42,141,491 T186P probably damaging Het
Tc2n C T 12: 101,649,195 S457N probably damaging Het
Tox4 A T 14: 52,292,628 S582C probably benign Het
Trappc12 T C 12: 28,697,134 probably benign Het
Ubqlnl G T 7: 104,148,638 Q551K probably damaging Het
Ubr4 A G 4: 139,392,124 T205A probably benign Het
Urb1 G A 16: 90,777,422 Q924* probably null Het
Vmn1r49 A G 6: 90,072,738 L94P probably damaging Het
Vmn2r120 T C 17: 57,508,949 Y802C probably damaging Het
Xrcc1 C T 7: 24,570,319 probably benign Het
Other mutations in Setx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00688:Setx APN 2 29148445 missense possibly damaging 0.50
IGL00806:Setx APN 2 29127026 missense probably damaging 1.00
IGL01346:Setx APN 2 29144809 missense probably damaging 1.00
IGL01623:Setx APN 2 29163009 missense possibly damaging 0.70
IGL02351:Setx APN 2 29146964 missense probably benign 0.45
IGL02358:Setx APN 2 29146964 missense probably benign 0.45
IGL02378:Setx APN 2 29173726 splice site probably benign
IGL02388:Setx APN 2 29173653 missense probably damaging 1.00
IGL02408:Setx APN 2 29133930 missense probably damaging 1.00
IGL02425:Setx APN 2 29148408 missense probably benign 0.00
IGL03023:Setx APN 2 29145902 missense probably benign 0.02
IGL03351:Setx APN 2 29161799 missense probably benign 0.25
addison UTSW 2 29158905 missense probably damaging 1.00
dallas UTSW 2 29154061 frame shift probably null
denton UTSW 2 29145060 missense possibly damaging 0.81
doggie UTSW 2 29164550 missense probably damaging 1.00
Irving UTSW 2 29139221 missense probably damaging 0.99
IGL03014:Setx UTSW 2 29139411 missense probably damaging 1.00
PIT4403001:Setx UTSW 2 29133955 missense probably damaging 1.00
R0027:Setx UTSW 2 29139221 missense probably damaging 0.99
R0031:Setx UTSW 2 29176929 missense probably benign 0.02
R0070:Setx UTSW 2 29161525 missense probably benign 0.00
R0070:Setx UTSW 2 29161525 missense probably benign 0.00
R0092:Setx UTSW 2 29146293 missense probably benign 0.00
R0193:Setx UTSW 2 29179673 missense probably benign 0.21
R0281:Setx UTSW 2 29179643 missense probably benign 0.00
R0401:Setx UTSW 2 29166289 nonsense probably null
R0413:Setx UTSW 2 29139278 missense probably damaging 1.00
R0536:Setx UTSW 2 29158248 missense possibly damaging 0.46
R0617:Setx UTSW 2 29146807 missense possibly damaging 0.86
R1183:Setx UTSW 2 29180092 missense probably benign
R1331:Setx UTSW 2 29179686 missense probably benign
R1465:Setx UTSW 2 29140389 critical splice donor site probably null
R1465:Setx UTSW 2 29140389 critical splice donor site probably null
R1467:Setx UTSW 2 29158905 missense probably damaging 1.00
R1467:Setx UTSW 2 29158905 missense probably damaging 1.00
R1482:Setx UTSW 2 29162992 missense probably damaging 0.99
R1599:Setx UTSW 2 29140373 missense probably benign 0.04
R1663:Setx UTSW 2 29126905 missense probably damaging 1.00
R1909:Setx UTSW 2 29163009 missense possibly damaging 0.70
R2117:Setx UTSW 2 29130301 missense probably benign 0.01
R2207:Setx UTSW 2 29154061 frame shift probably null
R2221:Setx UTSW 2 29154061 frame shift probably null
R2223:Setx UTSW 2 29148537 missense possibly damaging 0.89
R2223:Setx UTSW 2 29154061 frame shift probably null
R2273:Setx UTSW 2 29154061 frame shift probably null
R2274:Setx UTSW 2 29154061 frame shift probably null
R2275:Setx UTSW 2 29154061 frame shift probably null
R2309:Setx UTSW 2 29158904 missense probably damaging 1.00
R2328:Setx UTSW 2 29154060 frame shift probably null
R2328:Setx UTSW 2 29154061 frame shift probably null
R2329:Setx UTSW 2 29154061 frame shift probably null
R2331:Setx UTSW 2 29154061 frame shift probably null
R2332:Setx UTSW 2 29154061 frame shift probably null
R2429:Setx UTSW 2 29179898 missense probably benign 0.00
R2438:Setx UTSW 2 29154061 frame shift probably null
R2439:Setx UTSW 2 29154061 frame shift probably null
R2496:Setx UTSW 2 29144801 missense probably benign 0.11
R2858:Setx UTSW 2 29154061 frame shift probably null
R2859:Setx UTSW 2 29154061 frame shift probably null
R2884:Setx UTSW 2 29148625 missense probably damaging 0.98
R2885:Setx UTSW 2 29148625 missense probably damaging 0.98
R2886:Setx UTSW 2 29148625 missense probably damaging 0.98
R2915:Setx UTSW 2 29172324 missense probably damaging 0.99
R2921:Setx UTSW 2 29154060 small deletion probably benign
R2921:Setx UTSW 2 29154061 frame shift probably null
R2923:Setx UTSW 2 29154061 frame shift probably null
R3426:Setx UTSW 2 29154061 frame shift probably null
R3609:Setx UTSW 2 29154061 frame shift probably null
R3610:Setx UTSW 2 29154061 frame shift probably null
R3731:Setx UTSW 2 29154061 frame shift probably null
R3813:Setx UTSW 2 29154061 frame shift probably null
R3835:Setx UTSW 2 29145060 missense possibly damaging 0.81
R3871:Setx UTSW 2 29145741 missense probably damaging 0.98
R4013:Setx UTSW 2 29154061 frame shift probably null
R4014:Setx UTSW 2 29154061 frame shift probably null
R4015:Setx UTSW 2 29154061 frame shift probably null
R4017:Setx UTSW 2 29154061 frame shift probably null
R4246:Setx UTSW 2 29154061 frame shift probably null
R4248:Setx UTSW 2 29154061 frame shift probably null
R4297:Setx UTSW 2 29154061 frame shift probably null
R4298:Setx UTSW 2 29154061 frame shift probably null
R4539:Setx UTSW 2 29179748 missense probably benign 0.14
R4590:Setx UTSW 2 29144809 missense probably damaging 1.00
R4632:Setx UTSW 2 29148615 missense probably benign 0.23
R4782:Setx UTSW 2 29144046 missense probably damaging 0.99
R4801:Setx UTSW 2 29146373 missense probably benign 0.14
R4802:Setx UTSW 2 29146373 missense probably benign 0.14
R4975:Setx UTSW 2 29164550 missense probably damaging 1.00
R5040:Setx UTSW 2 29139338 missense probably damaging 1.00
R5133:Setx UTSW 2 29180081 missense probably benign 0.02
R5208:Setx UTSW 2 29166367 missense possibly damaging 0.63
R5237:Setx UTSW 2 29146983 missense probably benign 0.00
R5248:Setx UTSW 2 29148418 missense probably benign 0.26
R5288:Setx UTSW 2 29134033 critical splice donor site probably null
R5385:Setx UTSW 2 29134033 critical splice donor site probably null
R5387:Setx UTSW 2 29147594 missense probably benign 0.00
R5407:Setx UTSW 2 29145474 missense probably benign 0.00
R5685:Setx UTSW 2 29171280 missense probably damaging 1.00
R6110:Setx UTSW 2 29140290 missense probably damaging 1.00
R6136:Setx UTSW 2 29148027 missense probably benign 0.01
R6310:Setx UTSW 2 29176935 missense possibly damaging 0.57
R6328:Setx UTSW 2 29174462 intron probably benign
R6358:Setx UTSW 2 29171348 missense possibly damaging 0.79
R6384:Setx UTSW 2 29173558 missense probably damaging 1.00
R6400:Setx UTSW 2 29130274 missense probably damaging 0.97
R6572:Setx UTSW 2 29173694 missense possibly damaging 0.63
R6662:Setx UTSW 2 29158114 missense probably damaging 0.97
R6898:Setx UTSW 2 29148108 missense probably benign 0.00
R7188:Setx UTSW 2 29148172 missense probably benign 0.02
X0066:Setx UTSW 2 29147879 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCAACAGTTCCACGTAGTGCTC -3'
(R):5'- AGGACCAGCAGCAGCTAAAATGTC -3'

Sequencing Primer
(F):5'- CACGTAGTGCTCCACCAG -3'
(R):5'- TGTCCTAACACAAACTTGTCTTAC -3'
Posted On2013-06-12