Incidental Mutation 'R6082:Ptpn11'
ID482232
Institutional Source Beutler Lab
Gene Symbol Ptpn11
Ensembl Gene ENSMUSG00000043733
Gene Nameprotein tyrosine phosphatase, non-receptor type 11
SynonymsSHP-2, SH2 domain-containing protein tyrosine phosphatase-2, Syp, 2700084A17Rik, SH-PTP2, Shp2, PTP2C, PTP1D
MMRRC Submission 044241-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6082 (G1)
Quality Score156.008
Status Not validated
Chromosome5
Chromosomal Location121130533-121191397 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 121154526 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 253 (T253A)
Ref Sequence ENSEMBL: ENSMUSP00000098333 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054547] [ENSMUST00000100770]
Predicted Effect probably benign
Transcript: ENSMUST00000054547
AA Change: T253A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000058757
Gene: ENSMUSG00000043733
AA Change: T253A

DomainStartEndE-ValueType
SH2 4 87 8.34e-30 SMART
SH2 110 203 9.65e-35 SMART
PTPc 246 527 7.22e-133 SMART
low complexity region 563 573 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100770
AA Change: T253A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000098333
Gene: ENSMUSG00000043733
AA Change: T253A

DomainStartEndE-ValueType
SH2 4 87 8.34e-30 SMART
SH2 110 203 9.65e-35 SMART
PTPc 246 523 5.19e-134 SMART
low complexity region 559 569 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148407
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains two tandem Src homology-2 domains, which function as phospho-tyrosine binding domains and mediate the interaction of this PTP with its substrates. This PTP is widely expressed in most tissues and plays a regulatory role in various cell signaling events that are important for a diversity of cell functions, such as mitogenic activation, metabolic control, transcription regulation, and cell migration. Mutations in this gene are a cause of Noonan syndrome as well as acute myeloid leukemia. [provided by RefSeq, Aug 2016]
PHENOTYPE: Homozygous null mutants exhibit abnormal mesoderm patterning leading to a failure of gastrulation and death by embryonic day 10.5. In heterozygous state the null mutant acts as a dominant enhancer of a mild epidermal growth factor receptor mutation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A G 4: 42,972,511 M615V probably benign Het
A830018L16Rik T C 1: 11,798,528 I344T probably benign Het
Adamts19 G A 18: 58,968,774 A639T probably benign Het
Adamts9 T C 6: 92,889,949 D122G probably damaging Het
Bin2 A G 15: 100,645,148 S358P possibly damaging Het
Bora A T 14: 99,062,294 Q234L possibly damaging Het
Btaf1 C T 19: 36,983,542 R772C probably damaging Het
Cenpf T C 1: 189,658,104 E1177G probably benign Het
Clec4b2 A T 6: 123,204,141 probably null Het
Dedd2 G A 7: 25,211,290 P154S probably benign Het
Dennd5b A G 6: 149,068,695 S87P probably damaging Het
Dhx8 C T 11: 101,764,313 R1050W probably damaging Het
Eif3a T C 19: 60,772,130 K682R possibly damaging Het
Eif4e2 G T 1: 87,226,234 probably null Het
Ephb1 T C 9: 101,971,104 D665G probably damaging Het
Gbp7 G A 3: 142,545,936 V515M probably benign Het
Hnrnpdl C T 5: 100,036,481 G398S probably null Het
Hook3 C A 8: 26,110,785 A32S probably benign Het
Hoxb4 T C 11: 96,318,533 probably benign Het
Idi1 T A 13: 8,890,470 Y229* probably null Het
Lpl A T 8: 68,896,649 I276F probably damaging Het
Ltbp4 T C 7: 27,335,680 probably benign Het
Mphosph8 A G 14: 56,668,541 I64V probably damaging Het
Mroh1 A G 15: 76,430,223 D700G probably benign Het
Myt1l G A 12: 29,832,332 G509R unknown Het
Myt1l T C 12: 29,842,519 Y52H probably damaging Het
Nlrp9a T A 7: 26,567,977 D777E probably benign Het
Nudt4 A G 10: 95,551,456 I82T probably benign Het
Nwd2 T C 5: 63,805,031 C653R possibly damaging Het
Obscn A G 11: 58,999,567 Y7380H unknown Het
Olfr1045 A C 2: 86,198,317 V145G probably damaging Het
Olfr281 C T 15: 98,456,766 A152V probably damaging Het
Olfr46 A G 7: 140,610,681 T172A probably benign Het
Olfr918 C A 9: 38,672,570 R291S probably damaging Het
Ptk2 A T 15: 73,276,865 M409K probably damaging Het
Rabl6 C T 2: 25,583,825 probably benign Het
Rnf14 T C 18: 38,301,670 S57P possibly damaging Het
Scnm1 T C 3: 95,130,285 I157V probably benign Het
Slco1b2 A C 6: 141,663,670 I269L probably benign Het
Smchd1 A G 17: 71,349,719 Y1918H probably benign Het
Spag17 A T 3: 100,124,185 I2255F possibly damaging Het
Tnnt2 A G 1: 135,849,434 M199V probably benign Het
Tymp GC GCC 15: 89,374,364 probably null Het
Vmn2r73 T A 7: 85,858,221 I628L probably benign Het
Zc2hc1b C A 10: 13,171,311 E19* probably null Het
Other mutations in Ptpn11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01326:Ptpn11 APN 5 121143136 missense probably damaging 1.00
IGL03132:Ptpn11 APN 5 121134815 missense possibly damaging 0.94
noon UTSW 5 121144653 missense probably damaging 1.00
R0837:Ptpn11 UTSW 5 121149111 missense probably benign
R1544:Ptpn11 UTSW 5 121137511 missense probably benign 0.04
R2131:Ptpn11 UTSW 5 121172026 missense probably damaging 0.99
R4124:Ptpn11 UTSW 5 121137457 missense probably benign 0.00
R6331:Ptpn11 UTSW 5 121144653 missense probably damaging 1.00
R6628:Ptpn11 UTSW 5 121134829 splice site probably null
R7077:Ptpn11 UTSW 5 121143570 missense not run
Predicted Primers PCR Primer
(F):5'- CCATCACGACTGGTTATATTAGCC -3'
(R):5'- AGAGTTTTGTTGTTTGACCCACC -3'

Sequencing Primer
(F):5'- GGTTATATTAGCCAGCATGTGACCC -3'
(R):5'- CATGGATGGCTCATACGTACCATG -3'
Posted On2017-07-14