Incidental Mutation 'R6083:Ahnak2'
ID482328
Institutional Source Beutler Lab
Gene Symbol Ahnak2
Ensembl Gene ENSMUSG00000072812
Gene NameAHNAK nucleoprotein 2
SynonymsLOC382643
MMRRC Submission 044242-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R6083 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location112772194-112802657 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 112782999 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Proline at position 1076 (Q1076P)
Ref Sequence ENSEMBL: ENSMUSP00000114522 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124526]
Predicted Effect probably benign
Transcript: ENSMUST00000124526
AA Change: Q1076P

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000114522
Gene: ENSMUSG00000072812
AA Change: Q1076P

DomainStartEndE-ValueType
low complexity region 73 94 N/A INTRINSIC
PDZ 118 190 6e-4 SMART
low complexity region 268 281 N/A INTRINSIC
low complexity region 300 319 N/A INTRINSIC
low complexity region 405 429 N/A INTRINSIC
internal_repeat_1 465 898 2.74e-235 PROSPERO
low complexity region 905 923 N/A INTRINSIC
low complexity region 990 1013 N/A INTRINSIC
low complexity region 1076 1092 N/A INTRINSIC
internal_repeat_1 1145 1588 2.74e-235 PROSPERO
low complexity region 1590 1632 N/A INTRINSIC
low complexity region 1639 1700 N/A INTRINSIC
low complexity region 1709 1736 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137195
SMART Domains Protein: ENSMUSP00000116582
Gene: ENSMUSG00000072812

DomainStartEndE-ValueType
internal_repeat_1 2 521 3.81e-221 PROSPERO
low complexity region 557 569 N/A INTRINSIC
internal_repeat_1 606 1126 3.81e-221 PROSPERO
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 96% (76/79)
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik C A 11: 58,878,851 P73Q possibly damaging Het
Aak1 A T 6: 86,963,996 I591F unknown Het
Ace C A 11: 105,985,267 Y816* probably null Het
Ap2a1 G A 7: 44,907,751 R263W probably damaging Het
Arhgap29 A G 3: 121,992,748 T257A probably benign Het
Bora A T 14: 99,062,294 Q234L possibly damaging Het
Ccdc17 A T 4: 116,596,926 Q47L possibly damaging Het
Cep170 C T 1: 176,774,625 R305H probably damaging Het
Cyb5r4 C T 9: 87,057,168 P335S probably damaging Het
Cyp2c54 A G 19: 40,073,762 L17P probably benign Het
Cyp2c69 A T 19: 39,849,456 V394E probably damaging Het
Dedd2 G A 7: 25,211,290 P154S probably benign Het
Defb36 A T 2: 152,604,488 M1L unknown Het
Dnaja1 A G 4: 40,731,713 D263G probably benign Het
Dock10 T C 1: 80,532,431 N1560S probably damaging Het
Efnb2 T C 8: 8,622,328 probably null Het
Eif3e A G 15: 43,266,144 I196T probably damaging Het
Ercc4 T A 16: 13,110,039 C24* probably null Het
Fmn1 A G 2: 113,364,303 E116G unknown Het
Gnas A G 2: 174,297,862 M1V probably null Het
Grin2a C A 16: 9,579,540 M894I probably benign Het
Herc2 G T 7: 56,228,505 S4566I probably benign Het
Hmcn1 G A 1: 150,755,293 P918L probably damaging Het
Hmcn1 G T 1: 150,755,294 P918T probably damaging Het
Hsd3b2 T A 3: 98,712,056 Y191F possibly damaging Het
Ifit1bl2 A C 19: 34,619,817 F133C possibly damaging Het
Itih2 T C 2: 10,108,894 probably benign Het
Itsn1 T C 16: 91,853,011 L191P probably benign Het
Kdr T C 5: 75,944,366 K1068R probably damaging Het
Lmtk2 T C 5: 144,182,756 L1345P probably damaging Het
Man2b2 T A 5: 36,809,041 D936V probably damaging Het
Mapk1ip1 G A 7: 138,836,588 R38* probably null Het
Med13l T C 5: 118,721,486 V246A possibly damaging Het
Mlec T A 5: 115,148,049 T248S probably benign Het
Mslnl T A 17: 25,737,902 V54D possibly damaging Het
Muc16 G A 9: 18,657,212 T1337I unknown Het
Nek7 C T 1: 138,515,654 S187N probably damaging Het
Neto2 A G 8: 85,640,585 V538A probably benign Het
Nktr T C 9: 121,750,136 probably benign Het
Npy6r A G 18: 44,276,492 K327E probably damaging Het
Olfr1230 T A 2: 89,297,024 D82V probably damaging Het
Olfr1245 T C 2: 89,575,672 D18G probably benign Het
Olfr1463 A T 19: 13,234,525 I92F probably benign Het
Olfr402 A G 11: 74,155,570 M139V possibly damaging Het
Olfr705 A G 7: 106,873,582 I221T probably damaging Het
Pcdhga4 A T 18: 37,687,425 N676Y probably damaging Het
Pde2a T C 7: 101,502,879 I331T possibly damaging Het
Pip5k1b A T 19: 24,304,035 Y486* probably null Het
Plch2 A G 4: 155,000,818 M272T probably benign Het
Rbm12 G A 2: 156,097,726 probably benign Het
Rgs19 T C 2: 181,689,507 E111G probably damaging Het
Rhbdf1 T C 11: 32,210,066 N145S probably damaging Het
Rnf4 T A 5: 34,351,221 probably null Het
Rpa1 T C 11: 75,314,911 T207A probably damaging Het
Rufy4 A C 1: 74,129,397 Q113P probably damaging Het
Sh3pxd2b T G 11: 32,422,985 S717R probably benign Het
Sin3a A T 9: 57,107,540 I682F probably damaging Het
Sipa1l2 A T 8: 125,468,473 V842E possibly damaging Het
Slc5a4a A G 10: 76,147,597 I23V unknown Het
Slitrk5 A G 14: 111,681,725 N927S probably benign Het
Smc6 A G 12: 11,276,353 K117R possibly damaging Het
Sod2 G A 17: 13,008,031 probably benign Het
Stxbp1 A G 2: 32,796,018 I567T possibly damaging Het
Tbkbp1 C A 11: 97,147,380 L209F probably damaging Het
Tll1 G T 8: 64,038,586 probably null Het
Tmem38b T C 4: 53,840,765 L60S probably damaging Het
Trib1 G A 15: 59,654,475 R298H probably damaging Het
Trim30b A G 7: 104,366,142 V13A probably damaging Het
Trip11 G A 12: 101,889,742 T425I probably benign Het
Ttn C A 2: 76,889,973 probably benign Het
Tymp GC GCC 15: 89,374,364 probably null Het
Ush2a T A 1: 188,267,023 S177T probably damaging Het
Usp40 A T 1: 87,978,559 S651R probably benign Het
Vmn1r125 T C 7: 21,272,719 S181P probably damaging Het
Vmn1r198 T A 13: 22,354,758 V138D possibly damaging Het
Vmn1r56 A G 7: 5,196,318 L100P probably damaging Het
Vmn2r32 T A 7: 7,464,210 D773V probably benign Het
Vmn2r53 A C 7: 12,581,881 H670Q probably benign Het
Vmn2r69 A T 7: 85,406,503 I809N probably damaging Het
Wdr7 G A 18: 63,728,469 G184D probably damaging Het
Wnk1 C T 6: 120,037,601 G11D probably damaging Het
Zfp110 A C 7: 12,844,675 E171A possibly damaging Het
Zkscan6 T C 11: 65,815,931 V134A probably damaging Het
Other mutations in Ahnak2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02257:Ahnak2 APN 12 112785285 missense possibly damaging 0.79
IGL02994:Ahnak2 APN 12 112786207 missense probably damaging 0.99
PIT4480001:Ahnak2 UTSW 12 112773924 missense possibly damaging 0.79
PIT4810001:Ahnak2 UTSW 12 112785594 missense
R0025:Ahnak2 UTSW 12 112785534 missense probably damaging 0.99
R0025:Ahnak2 UTSW 12 112785534 missense probably damaging 0.99
R0038:Ahnak2 UTSW 12 112774462 missense probably benign 0.00
R0125:Ahnak2 UTSW 12 112785156 missense probably benign 0.41
R1173:Ahnak2 UTSW 12 112785789 missense probably damaging 1.00
R1494:Ahnak2 UTSW 12 112787950 missense probably damaging 1.00
R1712:Ahnak2 UTSW 12 112785378 missense probably benign 0.05
R1888:Ahnak2 UTSW 12 112773891 missense possibly damaging 0.49
R1888:Ahnak2 UTSW 12 112773891 missense possibly damaging 0.49
R2042:Ahnak2 UTSW 12 112785819 missense probably damaging 0.98
R2056:Ahnak2 UTSW 12 112785006 missense probably benign 0.00
R2417:Ahnak2 UTSW 12 112775371 missense probably damaging 1.00
R2762:Ahnak2 UTSW 12 112785364 missense probably damaging 0.96
R3618:Ahnak2 UTSW 12 112786222 missense probably damaging 1.00
R3706:Ahnak2 UTSW 12 112773651 missense possibly damaging 0.74
R3739:Ahnak2 UTSW 12 112774558 missense probably benign 0.05
R3950:Ahnak2 UTSW 12 112785789 missense probably damaging 1.00
R4485:Ahnak2 UTSW 12 112779767 unclassified probably benign
R4651:Ahnak2 UTSW 12 112774837 missense possibly damaging 0.93
R4652:Ahnak2 UTSW 12 112774837 missense possibly damaging 0.93
R4831:Ahnak2 UTSW 12 112775749 missense probably damaging 0.99
R4836:Ahnak2 UTSW 12 112774116 missense probably damaging 1.00
R4837:Ahnak2 UTSW 12 112785739 missense probably benign 0.00
R4864:Ahnak2 UTSW 12 112773606 missense probably damaging 0.98
R4908:Ahnak2 UTSW 12 112775272 missense probably benign 0.00
R5067:Ahnak2 UTSW 12 112785316 missense probably benign 0.01
R5146:Ahnak2 UTSW 12 112775726 missense probably benign 0.00
R5228:Ahnak2 UTSW 12 112775386 missense probably benign 0.03
R5255:Ahnak2 UTSW 12 112773378 missense possibly damaging 0.92
R5323:Ahnak2 UTSW 12 112779812 unclassified probably benign
R5523:Ahnak2 UTSW 12 112775208 missense probably damaging 1.00
R5733:Ahnak2 UTSW 12 112775666 nonsense probably null
R5799:Ahnak2 UTSW 12 112778930 unclassified probably benign
R5817:Ahnak2 UTSW 12 112774003 missense probably damaging 1.00
R5835:Ahnak2 UTSW 12 112775796 missense possibly damaging 0.66
R6083:Ahnak2 UTSW 12 112782612 missense probably benign 0.06
R6167:Ahnak2 UTSW 12 112783122 missense probably benign 0.03
R6168:Ahnak2 UTSW 12 112783122 missense probably benign 0.03
R6405:Ahnak2 UTSW 12 112773337 missense probably damaging 1.00
R6460:Ahnak2 UTSW 12 112786990 missense probably null 0.27
R6495:Ahnak2 UTSW 12 112773714 missense probably damaging 1.00
R6544:Ahnak2 UTSW 12 112780652 unclassified probably benign
R6656:Ahnak2 UTSW 12 112785371 missense probably benign 0.02
R6679:Ahnak2 UTSW 12 112772976 missense probably damaging 1.00
R6723:Ahnak2 UTSW 12 112778793 missense probably damaging 1.00
R6774:Ahnak2 UTSW 12 112773738 missense possibly damaging 0.87
R6884:Ahnak2 UTSW 12 112775429 missense possibly damaging 0.81
R6906:Ahnak2 UTSW 12 112785313 missense probably benign 0.00
R6919:Ahnak2 UTSW 12 112774684 missense possibly damaging 0.55
R7036:Ahnak2 UTSW 12 112778781 unclassified probably benign
R7037:Ahnak2 UTSW 12 112774278 missense probably damaging 0.99
R7064:Ahnak2 UTSW 12 112780742 unclassified probably benign
R7072:Ahnak2 UTSW 12 112788166 missense
R7112:Ahnak2 UTSW 12 112783119 missense
R7268:Ahnak2 UTSW 12 112780802 missense
R7269:Ahnak2 UTSW 12 112780802 missense
R7270:Ahnak2 UTSW 12 112780802 missense
R7271:Ahnak2 UTSW 12 112780802 missense
R7444:Ahnak2 UTSW 12 112781208 missense
R7448:Ahnak2 UTSW 12 112782502 missense
R7488:Ahnak2 UTSW 12 112785021 missense
Predicted Primers PCR Primer
(F):5'- TGAACTTGCTGTCTTTGGCC -3'
(R):5'- TTCAAGATGCCCTCCTTCGG -3'

Posted On2017-07-14