Incidental Mutation 'R6084:Bag4'
ID482391
Institutional Source Beutler Lab
Gene Symbol Bag4
Ensembl Gene ENSMUSG00000037316
Gene NameBCL2-associated athanogene 4
Synonyms
MMRRC Submission 044243-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.351) question?
Stock #R6084 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location25764538-25785287 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25771231 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 161 (T161A)
Ref Sequence ENSEMBL: ENSMUSP00000044725 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038498]
Predicted Effect probably benign
Transcript: ENSMUST00000038498
AA Change: T161A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000044725
Gene: ENSMUSG00000037316
AA Change: T161A

DomainStartEndE-ValueType
low complexity region 5 49 N/A INTRINSIC
low complexity region 64 79 N/A INTRINSIC
low complexity region 131 146 N/A INTRINSIC
low complexity region 255 268 N/A INTRINSIC
low complexity region 276 301 N/A INTRINSIC
BAG 379 456 3.66e-30 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167899
SMART Domains Protein: ENSMUSP00000130277
Gene: ENSMUSG00000091514

DomainStartEndE-ValueType
low complexity region 86 99 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209948
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210103
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the BAG1-related protein family. BAG1 is an anti-apoptotic protein that functions through interactions with a variety of cell apoptosis and growth related proteins including BCL-2, Raf-protein kinase, steroid hormone receptors, growth factor receptors and members of the heat shock protein 70 kDa family. This protein contains a BAG domain near the C-terminus, which could bind and inhibit the chaperone activity of Hsc70/Hsp70. This protein was found to be associated with the death domain of tumor necrosis factor receptor type 1 (TNF-R1) and death receptor-3 (DR3), and thereby negatively regulates downstream cell death signaling. The regulatory role of this protein in cell death was demonstrated in epithelial cells which undergo apoptosis while integrin mediated matrix contacts are lost. Alternatively spliced transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Mar 2011]
PHENOTYPE: Homozygous mutant animals may show enhanced cytokine response and increased IL-6 production following TNF challenge. Studies on two different alleles of this gene are not in agreement. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap2 T C 5: 62,670,954 D958G possibly damaging Het
Bora A T 14: 99,062,294 Q234L possibly damaging Het
Cacna2d2 T C 9: 107,497,521 probably null Het
Cass4 G T 2: 172,426,912 A307S probably benign Het
Cbln4 A T 2: 172,042,096 V68E probably damaging Het
Cc2d2a T A 5: 43,668,673 N2K probably benign Het
Ccnf T A 17: 24,231,837 D389V probably damaging Het
Cdipt T C 7: 126,979,601 S161P probably benign Het
Ceacam19 T C 7: 19,882,887 I161V probably benign Het
Cfap65 A G 1: 74,920,405 I862T probably damaging Het
Cfi T A 3: 129,858,370 L230Q probably benign Het
Chac2 G A 11: 30,986,159 R30W probably damaging Het
Cmc2 G A 8: 116,889,827 probably benign Het
Col1a2 A T 6: 4,505,840 M1L probably benign Het
Cox8a C A 19: 7,217,418 R32L possibly damaging Het
Cubn T A 2: 13,430,897 N1083Y probably damaging Het
D430042O09Rik G A 7: 125,814,865 G394R probably benign Het
D630003M21Rik T C 2: 158,217,584 D132G probably damaging Het
Dedd2 G A 7: 25,211,290 P154S probably benign Het
Dnaaf3 T C 7: 4,524,213 D358G probably benign Het
Dysf T A 6: 84,019,604 F29L probably damaging Het
Dysf T C 6: 84,112,119 L888P probably damaging Het
Ebf4 A G 2: 130,309,723 D277G probably damaging Het
Ecm2 T A 13: 49,515,094 L91* probably null Het
Foxs1 T C 2: 152,932,842 D97G possibly damaging Het
Frs2 A C 10: 117,076,809 probably null Het
Gm6768 A G 12: 119,261,651 noncoding transcript Het
Grp A T 18: 65,879,937 D58V probably damaging Het
Hif1a T G 12: 73,941,842 F537C probably damaging Het
Icam4 G A 9: 21,029,539 S29N probably benign Het
Itfg1 T C 8: 85,726,170 E523G probably benign Het
Jph2 T C 2: 163,375,680 K359E probably damaging Het
Kcnq2 A T 2: 181,087,656 V490E possibly damaging Het
Klhl18 C T 9: 110,428,727 M548I possibly damaging Het
Lpin3 A G 2: 160,895,801 Y197C probably benign Het
Lrp1 T C 10: 127,560,553 N2381D probably benign Het
Man1a A T 10: 53,919,211 W649R probably damaging Het
Map4 T C 9: 110,064,292 L542P probably damaging Het
Mboat2 A T 12: 24,878,285 H52L probably damaging Het
Mok C G 12: 110,814,946 S91T probably benign Het
Mtmr11 G T 3: 96,168,084 R360L probably damaging Het
Myt1l G A 12: 29,832,332 G509R unknown Het
Olfr1288 A T 2: 111,479,389 N202Y probably damaging Het
Olfr341 A G 2: 36,479,512 V206A probably benign Het
Olfr544 T C 7: 102,484,389 T244A probably damaging Het
Olfr67 C T 7: 103,787,955 M107I probably benign Het
Olfr836 A G 9: 19,121,327 D121G probably damaging Het
Olfr867 A T 9: 20,054,883 H75Q possibly damaging Het
Padi3 G T 4: 140,795,843 T292N probably damaging Het
Pard6g A C 18: 80,117,205 T178P possibly damaging Het
Pkd1l2 A T 8: 117,013,987 Y2124N probably damaging Het
Plxdc1 G A 11: 97,928,463 T398I probably damaging Het
Prickle2 A T 6: 92,416,848 C225* probably null Het
Prmt2 G A 10: 76,210,444 T317I probably benign Het
Psg22 T G 7: 18,719,780 N172K probably benign Het
Ptpn9 C T 9: 57,033,163 R196* probably null Het
Rap1b C T 10: 117,824,611 V14I probably damaging Het
Rapgef4 T A 2: 72,196,278 probably null Het
Rlf A T 4: 121,149,215 M856K possibly damaging Het
Rnf149 A G 1: 39,577,174 L34P probably benign Het
Rock1 T C 18: 10,101,007 E636G probably benign Het
Rsad2 A T 12: 26,454,123 Y136N probably damaging Het
Ryr3 T C 2: 112,908,493 H563R probably damaging Het
Slc18b1 A G 10: 23,804,212 M102V probably benign Het
Slc34a2 T A 5: 53,067,647 C377S possibly damaging Het
Slco1c1 T C 6: 141,546,770 V293A probably benign Het
Spidr A T 16: 16,140,024 S80T possibly damaging Het
Syne1 C T 10: 5,348,994 E1031K probably damaging Het
Synj2 G A 17: 6,017,614 V121I probably damaging Het
Synj2 A T 17: 6,038,098 T1430S probably damaging Het
Tecpr2 G T 12: 110,929,109 K343N probably damaging Het
Tmem132d T A 5: 127,784,100 I986F probably benign Het
Trib1 G A 15: 59,654,475 R298H probably damaging Het
Ttll10 T A 4: 156,045,357 D283V probably benign Het
Ttn T A 2: 76,814,779 K673* probably null Het
Ubqlnl T A 7: 104,148,698 M531L probably benign Het
Vmn2r120 A T 17: 57,525,721 W153R probably benign Het
Vmn2r2 A C 3: 64,117,046 S705A probably benign Het
Vmn2r32 T A 7: 7,464,210 D773V probably benign Het
Vmn2r54 T A 7: 12,632,278 Q243L probably damaging Het
Wdr24 C A 17: 25,824,530 R109S probably damaging Het
Zfp113 T C 5: 138,145,668 M107V probably benign Het
Zfp426 G T 9: 20,470,627 Q341K possibly damaging Het
Zfp616 A T 11: 74,083,846 K314* probably null Het
Other mutations in Bag4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02054:Bag4 APN 8 25771225 missense probably benign
IGL02074:Bag4 APN 8 25769355 missense possibly damaging 0.87
IGL02129:Bag4 APN 8 25768085 missense probably damaging 1.00
IGL02183:Bag4 APN 8 25768030 missense probably damaging 1.00
IGL02441:Bag4 APN 8 25768108 missense probably damaging 1.00
R0414:Bag4 UTSW 8 25767997 missense possibly damaging 0.91
R1103:Bag4 UTSW 8 25767863 utr 3 prime probably benign
R1423:Bag4 UTSW 8 25768274 missense probably damaging 0.99
R1650:Bag4 UTSW 8 25777424 missense probably damaging 0.99
R2045:Bag4 UTSW 8 25769488 missense probably benign
R2333:Bag4 UTSW 8 25769488 missense probably benign
R2945:Bag4 UTSW 8 25771252 missense probably benign 0.08
R3124:Bag4 UTSW 8 25769488 missense probably benign
R3125:Bag4 UTSW 8 25769488 missense probably benign
R4428:Bag4 UTSW 8 25769488 missense probably benign
R4429:Bag4 UTSW 8 25769488 missense probably benign
R4431:Bag4 UTSW 8 25769488 missense probably benign
R4467:Bag4 UTSW 8 25769488 missense probably benign
R4482:Bag4 UTSW 8 25785044 unclassified probably benign
R4538:Bag4 UTSW 8 25769488 missense probably benign
R4539:Bag4 UTSW 8 25769488 missense probably benign
R4541:Bag4 UTSW 8 25769488 missense probably benign
R4542:Bag4 UTSW 8 25769488 missense probably benign
R4663:Bag4 UTSW 8 25769488 missense probably benign
R4708:Bag4 UTSW 8 25769488 missense probably benign
R4710:Bag4 UTSW 8 25769488 missense probably benign
R4732:Bag4 UTSW 8 25769488 missense probably benign
R4733:Bag4 UTSW 8 25769488 missense probably benign
R4970:Bag4 UTSW 8 25771244 nonsense probably null
R5175:Bag4 UTSW 8 25768351 missense probably damaging 0.99
R6032:Bag4 UTSW 8 25777493 missense probably damaging 1.00
R6032:Bag4 UTSW 8 25777493 missense probably damaging 1.00
R6595:Bag4 UTSW 8 25769500 missense probably damaging 1.00
R6596:Bag4 UTSW 8 25769500 missense probably damaging 1.00
R7564:Bag4 UTSW 8 25777479 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACGGGAAACTGCTTACCTG -3'
(R):5'- TAGCTTATATGGTCATCGGTTACTGAC -3'

Posted On2017-07-14