Mutagenetix > Incidental Mutation

Incidental Mutation 'R6085:Etv1'

482441

Institutional Source

Beutler Lab

Gene Symbol

Etv1

Ensembl Gene

ENSMUSG00000004151

Gene Name

ets variant 1

Synonyms

Etsrp81, ER81

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.428) question?

Stock #

R6085 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

38829655-38920484 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 38904194 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Asparagine at position 285 (D285N)

Ref Sequence

ENSEMBL: ENSMUSP00000125692 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095767] [ENSMUST00000159334] [ENSMUST00000160244] [ENSMUST00000160701] [ENSMUST00000160856] [ENSMUST00000161980] [ENSMUST00000162563]

AlphaFold

P41164

Predicted Effect

possibly damaging
Transcript: ENSMUST00000095767
AA Change: D303N

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000093442
Gene: ENSMUSG00000004151
AA Change: D303N

Domain	Start	End	E-Value	Type
Pfam:ETS_PEA3_N	1	333	5e-153	PFAM
ETS	334	419	1.72e-57	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000159334
AA Change: D263N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000125676
Gene: ENSMUSG00000004151
AA Change: D263N

Domain	Start	End	E-Value	Type
Pfam:ETS_PEA3_N	16	293	1.1e-112	PFAM
ETS	294	379	1.72e-57	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000160244
AA Change: D280N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000125733
Gene: ENSMUSG00000004151
AA Change: D280N

Domain	Start	End	E-Value	Type
Pfam:ETS_PEA3_N	1	310	2.5e-133	PFAM
ETS	311	396	1.72e-57	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000160701
AA Change: D200N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000124019
Gene: ENSMUSG00000004151
AA Change: D200N

Domain	Start	End	E-Value	Type
Pfam:ETS_PEA3_N	14	82	1.4e-30	PFAM
Pfam:ETS_PEA3_N	80	230	1.6e-68	PFAM
ETS	231	316	1.72e-57	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000160856
AA Change: D285N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000125692
Gene: ENSMUSG00000004151
AA Change: D285N

Domain	Start	End	E-Value	Type
Pfam:ETS_PEA3_N	1	315	3.8e-130	PFAM
ETS	316	401	1.72e-57	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161591

Predicted Effect

probably damaging
Transcript: ENSMUST00000161980
AA Change: D245N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000124736
Gene: ENSMUSG00000004151
AA Change: D245N

Domain	Start	End	E-Value	Type
Pfam:ETS_PEA3_N	10	275	3.2e-104	PFAM
ETS	276	361	1.72e-57	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000162563
AA Change: D303N

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000125157
Gene: ENSMUSG00000004151
AA Change: D303N

Domain	Start	End	E-Value	Type
Pfam:ETS_PEA3_N	1	333	5.6e-150	PFAM
ETS	334	419	1.72e-57	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162730

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 94.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ETS (E twenty-six) family of transcription factors. The ETS proteins regulate many target genes that modulate biological processes like cell growth, angiogenesis, migration, proliferation and differentiation. All ETS proteins contain an ETS DNA-binding domain that binds to DNA sequences containing the consensus 5'-CGGA[AT]-3'. The protein encoded by this gene contains a conserved short acidic transactivation domain (TAD) in the N-terminal region, in addition to the ETS DNA-binding domain in the C-terminal region. This gene is involved in chromosomal translocations, which result in multiple fusion proteins including EWS-ETV1 in Ewing sarcoma and at least 10 ETV1 partners (see PMID: 19657377, Table 1) in prostate cancer. In addition to chromosomal rearrangement, this gene is overexpressed in prostate cancer, melanoma and gastrointestinal stromal tumor. Multiple alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous inactivation of this gene leads to premature death, ataxia, impaired limb coordination, defects in muscle innervation, muscle spindle differentiation and sensory-motor connectivity, deficient golgi tendon organs, and absence of Pacinian corpuscles and their afferents. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 22 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Boc	G	T	16: 44,308,970 (GRCm39)	D847E	probably damaging	Het
Bora	A	T	14: 99,299,730 (GRCm39)	Q234L	possibly damaging	Het
Cdk12	T	C	11: 98,134,255 (GRCm39)	I1051T	unknown	Het
Ciita	A	G	16: 10,330,029 (GRCm39)	E771G	probably benign	Het
Cul2	T	C	18: 3,431,508 (GRCm39)	F638L	probably benign	Het
Ddx21	A	G	10: 62,429,866 (GRCm39)	Y293H	probably damaging	Het
Dhx8	C	T	11: 101,655,139 (GRCm39)	R1050W	probably damaging	Het
Hs3st3a1	G	A	11: 64,327,004 (GRCm39)	V38I	possibly damaging	Het
Ifit1bl2	A	C	19: 34,597,217 (GRCm39)	F133C	possibly damaging	Het
Lama3	C	T	18: 12,615,156 (GRCm39)	T1360I	probably benign	Het
Mgrn1	A	G	16: 4,738,240 (GRCm39)	T265A	probably benign	Het
Nup155	T	C	15: 8,177,842 (GRCm39)	V1075A	probably damaging	Het
Or1ad6	A	G	11: 50,859,950 (GRCm39)	Y35C		Het
Pld4	A	G	12: 112,733,320 (GRCm39)	T299A	probably benign	Het
Prr5	T	A	15: 84,572,106 (GRCm39)	I38N	probably damaging	Het
Slc25a47	A	G	12: 108,820,254 (GRCm39)	Y86C	probably benign	Het
Spata31e5	T	C	1: 28,817,308 (GRCm39)	I241M	possibly damaging	Het
Synrg	A	T	11: 83,930,487 (GRCm39)	E1276D	possibly damaging	Het
Taar7e	T	C	10: 23,913,761 (GRCm39)	F84L	probably benign	Het
Tssk1	G	A	16: 17,712,848 (GRCm39)	C211Y	possibly damaging	Het
Tymp	GC	GCC	15: 89,258,567 (GRCm39)		probably null	Het
Xpo7	A	T	14: 70,934,051 (GRCm39)	S236T	probably benign	Het

Other mutations in Etv1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01113:Etv1	APN	12	38,831,791 (GRCm39)	splice site	probably benign
IGL01376:Etv1	APN	12	38,907,039 (GRCm39)	missense	probably damaging	1.00
IGL01387:Etv1	APN	12	38,911,326 (GRCm39)	missense	probably damaging	0.99
IGL01936:Etv1	APN	12	38,885,060 (GRCm39)	splice site	probably benign
IGL02388:Etv1	APN	12	38,831,798 (GRCm39)	missense	possibly damaging	0.62
IGL02933:Etv1	APN	12	38,831,832 (GRCm39)	missense	probably benign	0.22
R0844:Etv1	UTSW	12	38,911,353 (GRCm39)	missense	probably damaging	1.00
R0993:Etv1	UTSW	12	38,877,863 (GRCm39)	missense	probably damaging	1.00
R1187:Etv1	UTSW	12	38,915,563 (GRCm39)	missense	probably damaging	1.00
R1710:Etv1	UTSW	12	38,902,261 (GRCm39)	missense	probably benign	0.18
R2094:Etv1	UTSW	12	38,885,115 (GRCm39)	missense	probably null	1.00
R2879:Etv1	UTSW	12	38,833,809 (GRCm39)	splice site	probably null
R3607:Etv1	UTSW	12	38,881,085 (GRCm39)	missense	probably damaging	1.00
R4353:Etv1	UTSW	12	38,907,105 (GRCm39)	missense	probably damaging	1.00
R4646:Etv1	UTSW	12	38,915,685 (GRCm39)	missense	possibly damaging	0.94
R4678:Etv1	UTSW	12	38,885,219 (GRCm39)	missense	probably damaging	1.00
R4768:Etv1	UTSW	12	38,877,792 (GRCm39)	missense	probably damaging	1.00
R4812:Etv1	UTSW	12	38,911,287 (GRCm39)	missense	probably damaging	1.00
R4877:Etv1	UTSW	12	38,881,292 (GRCm39)	splice site	probably null
R5024:Etv1	UTSW	12	38,904,233 (GRCm39)	splice site	probably null
R5253:Etv1	UTSW	12	38,902,248 (GRCm39)	missense	possibly damaging	0.50
R5936:Etv1	UTSW	12	38,885,209 (GRCm39)	missense	probably damaging	1.00
R6167:Etv1	UTSW	12	38,915,640 (GRCm39)	missense	possibly damaging	0.88
R6709:Etv1	UTSW	12	38,833,796 (GRCm39)	missense	possibly damaging	0.93
R7046:Etv1	UTSW	12	38,834,369 (GRCm39)	splice site	probably null
R7243:Etv1	UTSW	12	38,907,045 (GRCm39)	missense	probably benign	0.36
R7616:Etv1	UTSW	12	38,915,605 (GRCm39)	missense	probably damaging	1.00
R8230:Etv1	UTSW	12	38,830,935 (GRCm39)	start codon destroyed	probably null	1.00
R9021:Etv1	UTSW	12	38,830,971 (GRCm39)	missense	probably benign	0.01
R9182:Etv1	UTSW	12	38,830,716 (GRCm39)	critical splice donor site	probably null
R9687:Etv1	UTSW	12	38,911,361 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCCACTTGATAGATGGAGGC -3'
(R):5'- AAAGATGCCCTGCTCAGCAC -3'

Sequencing Primer
(F):5'- GTCTCAAATATCAAATGGCTAGAAGG -3'
(R):5'- CCTAAGAGGTCAGTCAGGGG -3'

Posted On

2017-07-14