Incidental Mutation 'R0517:Cacna1d'
ID48245
Institutional Source Beutler Lab
Gene Symbol Cacna1d
Ensembl Gene ENSMUSG00000015968
Gene Namecalcium channel, voltage-dependent, L type, alpha 1D subunit
SynonymsC79217, Cchl1a2, Cav1.3alpha1, Cchl1a, Cacnl1a2, D-LTCC, 8430418G19Rik
MMRRC Submission 038710-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.660) question?
Stock #R0517 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location30039939-30491455 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 30179275 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 274 (I274K)
Ref Sequence ENSEMBL: ENSMUSP00000152953 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112249] [ENSMUST00000112250] [ENSMUST00000223803] [ENSMUST00000224198] [ENSMUST00000224395] [ENSMUST00000224785]
Predicted Effect probably damaging
Transcript: ENSMUST00000112249
AA Change: I274K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107868
Gene: ENSMUSG00000015968
AA Change: I274K

DomainStartEndE-ValueType
low complexity region 1 10 N/A INTRINSIC
low complexity region 54 67 N/A INTRINSIC
Pfam:Ion_trans 163 405 4.8e-59 PFAM
PDB:4DEY|B 406 502 3e-38 PDB
low complexity region 503 517 N/A INTRINSIC
Pfam:Ion_trans 557 751 5.5e-46 PFAM
low complexity region 766 781 N/A INTRINSIC
low complexity region 819 840 N/A INTRINSIC
Pfam:Ion_trans 921 1151 7.2e-51 PFAM
Pfam:Ion_trans 1239 1448 3.6e-67 PFAM
Pfam:PKD_channel 1285 1455 1.9e-9 PFAM
Blast:EFh 1469 1497 2e-9 BLAST
Ca_chan_IQ 1583 1617 5.05e-16 SMART
low complexity region 1649 1661 N/A INTRINSIC
low complexity region 1722 1728 N/A INTRINSIC
low complexity region 1830 1840 N/A INTRINSIC
low complexity region 1885 1905 N/A INTRINSIC
low complexity region 1921 1936 N/A INTRINSIC
low complexity region 2122 2133 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112250
AA Change: I296K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107869
Gene: ENSMUSG00000015968
AA Change: I296K

DomainStartEndE-ValueType
low complexity region 76 89 N/A INTRINSIC
Pfam:Ion_trans 147 439 5.6e-72 PFAM
low complexity region 473 482 N/A INTRINSIC
low complexity region 525 539 N/A INTRINSIC
Pfam:Ion_trans 544 784 2e-56 PFAM
low complexity region 788 803 N/A INTRINSIC
low complexity region 841 862 N/A INTRINSIC
Pfam:Ion_trans 907 1185 2.6e-63 PFAM
Pfam:Ion_trans 1226 1482 1.7e-70 PFAM
Pfam:PKD_channel 1306 1477 1.2e-9 PFAM
Pfam:GPHH 1484 1553 2.3e-38 PFAM
Ca_chan_IQ 1605 1639 5.05e-16 SMART
Pfam:CAC1F_C 1649 2165 1.1e-68 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000223803
AA Change: I274K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224073
Predicted Effect probably damaging
Transcript: ENSMUST00000224198
AA Change: I274K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000224395
AA Change: I274K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000224785
AA Change: I274K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.588 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 92.1%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: This gene encodes a pore-forming subunit of the L-type, voltage-activated calcium channel family. These channels have been found to play a role in heart and smooth muscle contraction and in the transmission of auditory information. Homozygous knockout mice for this gene exhibit deafness and heart defects. These channels have also been linked to mitochondrial oxidative stress in a mouse model of Parkinson's disease. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygotes for targeted mutations exhibit small size, hypoinsulinemia, glucose intolerance, decreased number and size of pancreatic islets, deafness with degeneration of hair cells, bradycardia, and arrhythmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410137M14Rik T A 17: 36,981,132 probably benign Het
Acer1 T C 17: 56,955,569 T194A probably benign Het
Adamts1 C A 16: 85,800,353 D10Y possibly damaging Het
Adamts7 T C 9: 90,199,858 V1612A probably benign Het
Adcyap1r1 T A 6: 55,491,297 S373T probably damaging Het
Armc4 A C 18: 7,223,621 L474R probably damaging Het
Asic5 A T 3: 82,009,526 I266F probably benign Het
Camsap2 G T 1: 136,293,388 Q238K possibly damaging Het
Ceacam15 A C 7: 16,673,520 L24* probably null Het
Cerk G A 15: 86,156,648 T170I probably damaging Het
Cyp27b1 T C 10: 127,050,116 probably null Het
Cyp2c65 T C 19: 39,082,348 probably benign Het
Dennd5a A G 7: 109,934,761 S75P probably damaging Het
Dhx9 C T 1: 153,478,916 A146T possibly damaging Het
Dpysl5 A G 5: 30,778,066 D171G probably damaging Het
Dsg3 A G 18: 20,529,025 N449S probably benign Het
Eps8l3 T C 3: 107,883,460 S189P probably benign Het
Exph5 A G 9: 53,372,762 E381G probably benign Het
Fam208b T A 13: 3,566,964 T2367S possibly damaging Het
Fbxo46 A G 7: 19,136,874 M473V possibly damaging Het
Fgf14 G A 14: 123,983,784 P203S probably damaging Het
Foxf2 C T 13: 31,626,243 A55V unknown Het
Galnt5 T G 2: 58,035,373 probably benign Het
Glis2 T C 16: 4,611,552 L181P probably damaging Het
Gm1000 T G 12: 104,476,408 probably benign Het
Helz2 A G 2: 181,227,770 S2959P probably benign Het
Hyal6 A G 6: 24,734,853 N262D probably benign Het
Lgr4 T C 2: 110,011,320 L526P probably damaging Het
Mapk1 A T 16: 17,016,046 I88F probably benign Het
Mpg A T 11: 32,231,853 H287L probably benign Het
Mpp4 A T 1: 59,124,727 Y489* probably null Het
Mpzl1 T C 1: 165,601,790 E224G probably damaging Het
Myh10 A G 11: 68,811,599 probably null Het
Olfr1034 T C 2: 86,047,204 S241P probably damaging Het
Olfr1340 T A 4: 118,726,634 I129K probably damaging Het
Paip1 T A 13: 119,447,790 F196I probably damaging Het
Pde3a A T 6: 141,498,657 K1064* probably null Het
Pira2 A T 7: 3,844,197 probably benign Het
Pros1 A G 16: 62,903,518 S210G probably benign Het
Rbm15 A T 3: 107,331,369 L571Q probably damaging Het
Scn1a T A 2: 66,302,407 T1194S possibly damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Serpina1e G A 12: 103,949,227 T240I probably benign Het
Setx T G 2: 29,157,133 S1874R probably benign Het
Sgsm2 G T 11: 74,867,651 T256K possibly damaging Het
Slc44a1 T C 4: 53,542,366 V300A probably damaging Het
Spata46 A G 1: 170,311,609 Y59C probably damaging Het
Supt3 T C 17: 45,119,271 F404L probably benign Het
Tars T A 15: 11,394,366 K62* probably null Het
Tas2r139 A C 6: 42,141,491 T186P probably damaging Het
Tc2n C T 12: 101,649,195 S457N probably damaging Het
Tox4 A T 14: 52,292,628 S582C probably benign Het
Trappc12 T C 12: 28,697,134 probably benign Het
Ubqlnl G T 7: 104,148,638 Q551K probably damaging Het
Ubr4 A G 4: 139,392,124 T205A probably benign Het
Urb1 G A 16: 90,777,422 Q924* probably null Het
Vmn1r49 A G 6: 90,072,738 L94P probably damaging Het
Vmn2r120 T C 17: 57,508,949 Y802C probably damaging Het
Xrcc1 C T 7: 24,570,319 probably benign Het
Other mutations in Cacna1d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Cacna1d APN 14 30096950 missense probably damaging 0.97
IGL00857:Cacna1d APN 14 30350681 missense possibly damaging 0.83
IGL01015:Cacna1d APN 14 30051742 splice site probably benign
IGL01420:Cacna1d APN 14 30051638 missense probably benign 0.01
IGL01470:Cacna1d APN 14 30099142 missense probably damaging 0.99
IGL01560:Cacna1d APN 14 30099206 missense probably benign 0.00
IGL01617:Cacna1d APN 14 30102371 missense probably damaging 1.00
IGL01820:Cacna1d APN 14 30042866 missense possibly damaging 0.79
IGL01948:Cacna1d APN 14 30124794 missense probably damaging 1.00
IGL02702:Cacna1d APN 14 30123533 nonsense probably null
IGL02864:Cacna1d APN 14 30051706 missense probably benign 0.10
IGL03082:Cacna1d APN 14 30099233 missense probably damaging 1.00
brisk UTSW 14 30171314 missense possibly damaging 0.91
troppo UTSW 14 30123454 missense probably damaging 1.00
PIT4651001:Cacna1d UTSW 14 30178645 missense probably damaging 1.00
R0015:Cacna1d UTSW 14 30114971 missense probably benign 0.00
R0015:Cacna1d UTSW 14 30114971 missense probably benign 0.00
R0033:Cacna1d UTSW 14 30105489 missense probably damaging 0.99
R0047:Cacna1d UTSW 14 30346790 splice site probably benign
R0047:Cacna1d UTSW 14 30346790 splice site probably benign
R0051:Cacna1d UTSW 14 30111095 missense probably damaging 1.00
R0051:Cacna1d UTSW 14 30111095 missense probably damaging 1.00
R0067:Cacna1d UTSW 14 30075010 unclassified probably benign
R0067:Cacna1d UTSW 14 30075010 unclassified probably benign
R0238:Cacna1d UTSW 14 30123496 missense probably benign 0.29
R0238:Cacna1d UTSW 14 30123496 missense probably benign 0.29
R0239:Cacna1d UTSW 14 30123496 missense probably benign 0.29
R0239:Cacna1d UTSW 14 30123496 missense probably benign 0.29
R0240:Cacna1d UTSW 14 30096969 missense probably benign 0.00
R0240:Cacna1d UTSW 14 30096969 missense probably benign 0.00
R0284:Cacna1d UTSW 14 30072105 missense probably damaging 1.00
R0416:Cacna1d UTSW 14 30100688 splice site probably benign
R0427:Cacna1d UTSW 14 30346817 missense probably damaging 0.99
R0639:Cacna1d UTSW 14 30171294 critical splice donor site probably null
R0727:Cacna1d UTSW 14 30130115 critical splice donor site probably null
R0732:Cacna1d UTSW 14 30042920 missense probably damaging 0.99
R0843:Cacna1d UTSW 14 30124871 missense probably damaging 1.00
R0900:Cacna1d UTSW 14 30111082 missense probably damaging 1.00
R1278:Cacna1d UTSW 14 30178703 missense probably damaging 1.00
R1340:Cacna1d UTSW 14 30072067 missense probably damaging 0.96
R1527:Cacna1d UTSW 14 30107796 missense probably damaging 1.00
R1711:Cacna1d UTSW 14 30066056 missense probably damaging 1.00
R1736:Cacna1d UTSW 14 30089863 missense probably damaging 1.00
R1763:Cacna1d UTSW 14 30099196 missense probably benign 0.25
R2034:Cacna1d UTSW 14 30089863 missense probably damaging 1.00
R2086:Cacna1d UTSW 14 30047357 missense possibly damaging 0.83
R2126:Cacna1d UTSW 14 30123163 missense probably damaging 1.00
R2218:Cacna1d UTSW 14 30123091 missense probably damaging 1.00
R2219:Cacna1d UTSW 14 30042090 missense probably damaging 1.00
R2262:Cacna1d UTSW 14 30491016 missense possibly damaging 0.46
R2291:Cacna1d UTSW 14 30042342 missense probably damaging 1.00
R2399:Cacna1d UTSW 14 30052487 missense probably benign 0.34
R2424:Cacna1d UTSW 14 30049023 missense probably damaging 0.96
R2568:Cacna1d UTSW 14 30082511 missense probably damaging 0.99
R4038:Cacna1d UTSW 14 30066083 missense probably damaging 0.96
R4509:Cacna1d UTSW 14 30096971 missense probably damaging 1.00
R4649:Cacna1d UTSW 14 30095408 missense probably benign
R4650:Cacna1d UTSW 14 30095408 missense probably benign
R4652:Cacna1d UTSW 14 30095408 missense probably benign
R5009:Cacna1d UTSW 14 30079332 missense probably damaging 1.00
R5058:Cacna1d UTSW 14 30114244 nonsense probably null
R5063:Cacna1d UTSW 14 30051383 missense probably benign
R5138:Cacna1d UTSW 14 30490972 missense probably benign
R5151:Cacna1d UTSW 14 30123323 missense probably damaging 1.00
R5278:Cacna1d UTSW 14 30352924 critical splice donor site probably null
R5286:Cacna1d UTSW 14 30350725 missense possibly damaging 0.69
R5313:Cacna1d UTSW 14 30346841 missense probably benign 0.38
R5383:Cacna1d UTSW 14 30045279 missense possibly damaging 0.51
R5387:Cacna1d UTSW 14 30100751 missense probably damaging 1.00
R5514:Cacna1d UTSW 14 30350833 nonsense probably null
R5524:Cacna1d UTSW 14 30042129 missense probably benign 0.01
R5663:Cacna1d UTSW 14 30123340 missense probably damaging 1.00
R5712:Cacna1d UTSW 14 30074997 missense probably damaging 1.00
R5796:Cacna1d UTSW 14 30066116 missense probably damaging 1.00
R5906:Cacna1d UTSW 14 30096960 missense probably damaging 1.00
R5923:Cacna1d UTSW 14 30111148 missense probably damaging 1.00
R5936:Cacna1d UTSW 14 30171314 missense possibly damaging 0.91
R5938:Cacna1d UTSW 14 30103735 missense probably damaging 1.00
R6041:Cacna1d UTSW 14 30042357 missense probably damaging 1.00
R6432:Cacna1d UTSW 14 30123454 missense probably damaging 1.00
R6486:Cacna1d UTSW 14 30114233 missense probably benign 0.01
R6600:Cacna1d UTSW 14 30114235 missense probably benign 0.15
R6661:Cacna1d UTSW 14 30089875 missense probably damaging 1.00
R6753:Cacna1d UTSW 14 30042786 missense probably damaging 1.00
R6804:Cacna1d UTSW 14 30051665 missense probably benign 0.00
R6851:Cacna1d UTSW 14 30042782 missense probably damaging 1.00
R6863:Cacna1d UTSW 14 30075852 missense probably damaging 1.00
R6916:Cacna1d UTSW 14 30095364 missense probably damaging 1.00
R6925:Cacna1d UTSW 14 30051637 missense probably benign
R7066:Cacna1d UTSW 14 30352978 intron probably benign
R7188:Cacna1d UTSW 14 30089833 missense probably benign
R7242:Cacna1d UTSW 14 30178706 missense probably benign 0.00
R7249:Cacna1d UTSW 14 30142703 missense probably damaging 1.00
R7250:Cacna1d UTSW 14 30075151 missense probably damaging 1.00
R7274:Cacna1d UTSW 14 30142643 missense probably damaging 1.00
R7336:Cacna1d UTSW 14 30045282 missense probably benign 0.18
R7343:Cacna1d UTSW 14 30123057 missense probably benign 0.02
R7411:Cacna1d UTSW 14 30352990 start codon destroyed probably null
R7461:Cacna1d UTSW 14 30066163 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GAATTCAGCCTCTTCTGGTCACCAC -3'
(R):5'- GGCACTAAACCCCATGCTTTGC -3'

Sequencing Primer
(F):5'- CAGAGAATGGGGCTGCCTG -3'
(R):5'- tctagtgaaggagttggactaaatg -3'
Posted On2013-06-12