Incidental Mutation 'R6086:Enpp2'
ID482510
Institutional Source Beutler Lab
Gene Symbol Enpp2
Ensembl Gene ENSMUSG00000022425
Gene Nameectonucleotide pyrophosphatase/phosphodiesterase 2
SynonymsPdnp2, Npps2, PD-Ialpha, ATX, Autotaxin
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6086 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location54838901-54952892 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 54845834 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 795 (D795G)
Ref Sequence ENSEMBL: ENSMUSP00000133877 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041591] [ENSMUST00000167541] [ENSMUST00000171545] [ENSMUST00000173516]
Predicted Effect probably damaging
Transcript: ENSMUST00000041591
AA Change: D747G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000036180
Gene: ENSMUSG00000022425
AA Change: D747G

DomainStartEndE-ValueType
SO 54 97 4.79e-16 SMART
SO 98 141 2.95e-16 SMART
Pfam:Phosphodiest 165 285 4.7e-41 PFAM
Pfam:Phosphodiest 278 477 3.3e-40 PFAM
Endonuclease_NS 613 844 3.93e-36 SMART
NUC 614 844 1.32e-109 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167541
AA Change: D772G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132640
Gene: ENSMUSG00000022425
AA Change: D772G

DomainStartEndE-ValueType
SO 54 97 4.79e-16 SMART
SO 98 141 2.95e-16 SMART
Pfam:Phosphodiest 165 284 5.4e-41 PFAM
Pfam:Phosphodiest 278 477 3.4e-40 PFAM
Endonuclease_NS 638 869 3.93e-36 SMART
NUC 639 869 1.32e-109 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000171545
AA Change: D799G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128941
Gene: ENSMUSG00000022425
AA Change: D799G

DomainStartEndE-ValueType
SO 54 97 4.79e-16 SMART
SO 98 141 2.95e-16 SMART
Pfam:Phosphodiest 165 283 2.8e-43 PFAM
Pfam:Phosphodiest 275 529 2.8e-36 PFAM
Endonuclease_NS 665 896 3.93e-36 SMART
NUC 666 896 1.32e-109 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000173516
AA Change: D795G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133877
Gene: ENSMUSG00000022425
AA Change: D795G

DomainStartEndE-ValueType
SO 54 97 4.79e-16 SMART
SO 98 141 2.95e-16 SMART
Pfam:Phosphodiest 165 285 2.8e-41 PFAM
Pfam:Phosphodiest 276 529 7.8e-36 PFAM
Endonuclease_NS 661 892 3.93e-36 SMART
NUC 662 892 1.32e-109 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 96% (65/68)
MGI Phenotype FUNCTION: This gene encodes a member of the phosphodiesterase and nucleotide pyrophosphatase family of bifunctional enzymes that hydrolize phosphodiester bonds of various nucleotides. The encoded protein undergoes proteolytic processing to generate a mature protein with lysophospholipase D activity, catalyzing the cleavage of the choline group from lysophosphatidylcholine to produce lysophosphatidic acid. This gene is expressed in numerous tissues and participates in neural development, obesity, inflammation and oncogenesis. A complete lack of the encoded protein in mice results in aberrant vascular and neuronal development leading to embryonic lethality. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar processing to generate the mature protein. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality during organogenesis, absent yolk sac vasculature, abnormal vasculature, and variable penetrance of impaired embryo turning, edema, failure of chorioallantoic fusion, neural tube malformations, and abnormal forebrain development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110062M04Rik A G 6: 34,874,620 S127P probably damaging Het
Apob G T 12: 8,015,164 K4044N probably benign Het
Asic4 G A 1: 75,473,243 V468I possibly damaging Het
Atf4 T A 15: 80,257,453 V348D probably benign Het
Bcl9 A G 3: 97,205,524 V1205A possibly damaging Het
Bora A T 14: 99,062,294 Q234L possibly damaging Het
Cap2 C A 13: 46,635,712 P131Q probably damaging Het
Cdyl2 A G 8: 116,589,296 S318P probably damaging Het
Ces1a T G 8: 93,027,353 N341H probably benign Het
Crlf3 C T 11: 80,048,610 V352M possibly damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dnah2 T C 11: 69,516,008 T529A probably benign Het
Dnah9 C T 11: 65,989,915 D2619N probably damaging Het
Dnah9 A C 11: 66,085,174 S1350A probably benign Het
Dnajc6 C T 4: 101,597,807 S65L probably benign Het
Dnm3 C A 1: 162,321,033 R256S probably damaging Het
Fah A T 7: 84,588,912 W367R probably damaging Het
Fam220a T A 5: 143,563,041 H69Q probably benign Het
Fgd3 T A 13: 49,287,296 T220S probably benign Het
Furin G T 7: 80,395,431 H248Q probably damaging Het
Gabrg1 A T 5: 70,754,053 L410Q probably damaging Het
Gm10801 AAGT AAGTAGT 2: 98,663,803 probably null Het
Gm9742 T C 13: 8,030,033 noncoding transcript Het
Gpcpd1 A G 2: 132,538,114 S252P probably damaging Het
Hnrnpdl C T 5: 100,036,481 G398S probably null Het
Hspa1l T C 17: 34,978,155 V390A possibly damaging Het
Htr3b T C 9: 48,947,298 S94G probably benign Het
Klf10 G T 15: 38,296,937 S271R probably benign Het
Klk1b3 T A 7: 44,201,734 L197Q probably damaging Het
Knl1 A G 2: 119,094,068 R1861G probably damaging Het
Lexm T C 4: 106,613,206 E218G probably damaging Het
Myo9a C T 9: 59,790,057 Q374* probably null Het
Myt1l G A 12: 29,832,332 G509R unknown Het
Ncapg T C 5: 45,693,236 L728P probably damaging Het
Nfxl1 A C 5: 72,541,019 F228V probably benign Het
Oc90 A G 15: 65,889,711 S153P probably damaging Het
Olfr1230 A G 2: 89,296,854 C139R probably damaging Het
Olfr1458 A G 19: 13,102,381 *308Q probably null Het
Pbk A T 14: 65,815,253 K182* probably null Het
Piezo1 A G 8: 122,501,657 F296S possibly damaging Het
Psmg1 T A 16: 95,980,044 Y288F probably damaging Het
Rab11fip4 G A 11: 79,683,480 D132N probably damaging Het
Recql4 T C 15: 76,704,587 D1051G probably damaging Het
Reep5 A C 18: 34,357,131 D104E probably damaging Het
Rnpepl1 T C 1: 92,917,681 Y441H probably damaging Het
Scnm1 T C 3: 95,130,285 I157V probably benign Het
Sema3b T C 9: 107,600,848 D446G probably damaging Het
Sema4d C T 13: 51,713,745 R190Q probably damaging Het
Slco3a1 G A 7: 74,318,590 R461C possibly damaging Het
Tcrg-C3 T C 13: 19,263,284 S136P probably damaging Het
Tenm2 T A 11: 36,008,646 I2562F possibly damaging Het
Thegl T A 5: 77,061,305 V458E probably benign Het
Tmem40 G T 6: 115,733,667 N120K possibly damaging Het
Tmod3 T C 9: 75,500,123 H351R probably benign Het
Tnn C T 1: 160,086,120 V1268M probably damaging Het
Tpmt T A 13: 47,035,030 D132V probably damaging Het
Trib1 G A 15: 59,654,475 R298H probably damaging Het
Tsen2 A G 6: 115,560,075 E264G probably benign Het
Urah A G 7: 140,836,798 I60M probably benign Het
Vmn2r26 T A 6: 124,039,560 S328T possibly damaging Het
Vmn2r27 G C 6: 124,191,999 T724R probably damaging Het
Washc2 A G 6: 116,256,216 probably null Het
Wdyhv1 C A 15: 58,150,628 A71E probably damaging Het
Zfp955b T A 17: 33,302,504 W316R probably benign Het
Zranb2 T C 3: 157,543,246 probably null Het
Other mutations in Enpp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00857:Enpp2 APN 15 54875650 critical splice donor site probably null
IGL01290:Enpp2 APN 15 54919602 missense possibly damaging 0.79
IGL01296:Enpp2 APN 15 54875669 missense probably damaging 1.00
IGL01650:Enpp2 APN 15 54919933 missense probably benign
IGL02470:Enpp2 APN 15 54839460 missense probably damaging 1.00
IGL02522:Enpp2 APN 15 54898940 missense probably damaging 0.99
IGL02727:Enpp2 APN 15 54910181 missense probably damaging 1.00
IGL03178:Enpp2 APN 15 54866006 missense probably benign
IGL03055:Enpp2 UTSW 15 54866085 intron probably null
PIT4260001:Enpp2 UTSW 15 54844378 critical splice donor site probably null
R0302:Enpp2 UTSW 15 54860061 missense probably benign 0.15
R0304:Enpp2 UTSW 15 54877806 missense probably benign 0.07
R0385:Enpp2 UTSW 15 54882159 missense probably damaging 1.00
R0440:Enpp2 UTSW 15 54847237 splice site probably benign
R0696:Enpp2 UTSW 15 54897696 nonsense probably null
R0879:Enpp2 UTSW 15 54877930 missense probably damaging 0.98
R0924:Enpp2 UTSW 15 54906959 splice site probably benign
R0989:Enpp2 UTSW 15 54875759 missense possibly damaging 0.88
R1126:Enpp2 UTSW 15 54906826 critical splice donor site probably null
R1434:Enpp2 UTSW 15 54862681 missense probably damaging 1.00
R1447:Enpp2 UTSW 15 54919598 critical splice donor site probably null
R1464:Enpp2 UTSW 15 54863812 missense probably damaging 1.00
R1464:Enpp2 UTSW 15 54863812 missense probably damaging 1.00
R1501:Enpp2 UTSW 15 54839514 missense probably damaging 1.00
R1546:Enpp2 UTSW 15 54845829 missense probably benign 0.01
R1673:Enpp2 UTSW 15 54910196 splice site probably null
R1853:Enpp2 UTSW 15 54845823 missense probably damaging 1.00
R1854:Enpp2 UTSW 15 54845823 missense probably damaging 1.00
R1855:Enpp2 UTSW 15 54845823 missense probably damaging 1.00
R1969:Enpp2 UTSW 15 54882982 missense probably damaging 1.00
R1970:Enpp2 UTSW 15 54882982 missense probably damaging 1.00
R2060:Enpp2 UTSW 15 54875714 missense probably damaging 1.00
R2122:Enpp2 UTSW 15 54897792 nonsense probably null
R2275:Enpp2 UTSW 15 54897794 missense probably damaging 1.00
R2517:Enpp2 UTSW 15 54919694 missense probably damaging 0.99
R3881:Enpp2 UTSW 15 54919692 missense probably damaging 1.00
R3934:Enpp2 UTSW 15 54845921 missense probably benign 0.03
R4722:Enpp2 UTSW 15 54887589 missense probably damaging 0.99
R4765:Enpp2 UTSW 15 54875672 missense possibly damaging 0.91
R4799:Enpp2 UTSW 15 54910094 missense probably damaging 1.00
R4934:Enpp2 UTSW 15 54882147 missense probably damaging 1.00
R4976:Enpp2 UTSW 15 54870305 nonsense probably null
R5068:Enpp2 UTSW 15 54864054 missense probably damaging 1.00
R5069:Enpp2 UTSW 15 54864054 missense probably damaging 1.00
R5070:Enpp2 UTSW 15 54864054 missense probably damaging 1.00
R5119:Enpp2 UTSW 15 54870305 nonsense probably null
R5134:Enpp2 UTSW 15 54899330 missense probably damaging 1.00
R5162:Enpp2 UTSW 15 54847296 missense probably benign 0.06
R5218:Enpp2 UTSW 15 54887586 missense possibly damaging 0.86
R5415:Enpp2 UTSW 15 54882156 missense probably damaging 1.00
R5965:Enpp2 UTSW 15 54882971 critical splice donor site probably null
R6229:Enpp2 UTSW 15 54877832 missense probably damaging 1.00
R6306:Enpp2 UTSW 15 54899346 missense probably damaging 1.00
R6314:Enpp2 UTSW 15 54865970 missense probably damaging 0.99
R6403:Enpp2 UTSW 15 54863764 missense probably damaging 1.00
R6515:Enpp2 UTSW 15 54860093 missense possibly damaging 0.75
R6525:Enpp2 UTSW 15 54870211 missense probably benign 0.01
R6536:Enpp2 UTSW 15 54862631 missense probably damaging 1.00
R7070:Enpp2 UTSW 15 54899289 missense probably damaging 1.00
R7077:Enpp2 UTSW 15 54901391 missense probably benign 0.36
R7265:Enpp2 UTSW 15 54910033 critical splice donor site probably null
R7324:Enpp2 UTSW 15 54877774 critical splice donor site probably null
R7331:Enpp2 UTSW 15 54875670 missense probably damaging 1.00
R7452:Enpp2 UTSW 15 54866736 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGGAAACGTGTATATCACAAACCTC -3'
(R):5'- TGCAGAGAGTTTGTCTGAACC -3'

Posted On2017-07-14