Incidental Mutation 'R6072:Ccdc173'
ID482526
Institutional Source Beutler Lab
Gene Symbol Ccdc173
Ensembl Gene ENSMUSG00000070883
Gene Namecoiled-coil domain containing 173
Synonyms4930525K21Rik, 4930578N16Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R6072 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location69758033-69789575 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 69772058 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 336 (D336E)
Ref Sequence ENSEMBL: ENSMUSP00000092548 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094942]
Predicted Effect probably benign
Transcript: ENSMUST00000094942
AA Change: D336E

PolyPhen 2 Score 0.307 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000092548
Gene: ENSMUSG00000070883
AA Change: D336E

DomainStartEndE-ValueType
coiled coil region 47 131 N/A INTRINSIC
Pfam:TPH 142 475 8.9e-22 PFAM
low complexity region 494 508 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik A T 11: 23,517,357 M92K probably benign Het
3110001I22Rik T C 16: 13,677,489 S151P probably damaging Het
Abca15 T A 7: 120,388,258 C1256S probably damaging Het
Asic2 A G 11: 80,894,088 S291P probably damaging Het
Asph A G 4: 9,643,533 probably null Het
Ccdc57 T A 11: 120,902,075 K284N probably damaging Het
Dnm3 CAGCCTTCGTTGGGTG C 1: 162,011,068 probably benign Het
Dopey1 G A 9: 86,507,697 S558N probably benign Het
F830045P16Rik T A 2: 129,472,694 Q221L probably damaging Het
Gm10146 A G 10: 78,393,498 noncoding transcript Het
Gys2 T G 6: 142,428,537 D594A probably damaging Het
Irf9 A G 14: 55,605,827 E114G probably damaging Het
Itpr2 T G 6: 146,347,111 K1082T probably damaging Het
Krt14 C T 11: 100,207,166 G97D unknown Het
Lmo7 A T 14: 101,929,336 probably benign Het
Nckap5l A T 15: 99,426,654 L656Q probably damaging Het
Ndufs8 T C 19: 3,909,275 T129A probably damaging Het
Nosip G A 7: 45,076,648 V187M possibly damaging Het
Olfr723 A T 14: 49,929,149 Y132N probably damaging Het
Olfr830 G A 9: 18,875,422 V29I probably benign Het
Phf3 A C 1: 30,830,688 N426K probably benign Het
Plekha6 G C 1: 133,272,307 R208P possibly damaging Het
Ptpru A G 4: 131,776,228 S1164P probably damaging Het
Rcan1 T C 16: 92,465,927 D51G probably benign Het
Rem1 A G 2: 152,634,517 T232A probably benign Het
Slc1a3 T A 15: 8,708,568 I59F probably damaging Het
Slc23a4 T C 6: 34,948,422 K491E probably benign Het
Slc6a5 T A 7: 49,912,195 D158E probably damaging Het
Smarca4 A G 9: 21,700,121 N1510S probably damaging Het
Taf1d T C 9: 15,311,560 S241P probably benign Het
Thada T C 17: 84,192,006 D1921G possibly damaging Het
Tmem147 A T 7: 30,728,020 M99K possibly damaging Het
Tulp1 T C 17: 28,363,784 E130G possibly damaging Het
Tyw1 T C 5: 130,267,911 V123A possibly damaging Het
Wdr75 T C 1: 45,799,051 V40A probably damaging Het
Zfp683 T C 4: 134,055,746 Y174H probably benign Het
Other mutations in Ccdc173
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Ccdc173 APN 2 69771984 missense probably benign
IGL01768:Ccdc173 APN 2 69782127 splice site probably benign
IGL01801:Ccdc173 APN 2 69776279 splice site probably benign
R0553:Ccdc173 UTSW 2 69789441 missense probably damaging 1.00
R1226:Ccdc173 UTSW 2 69787209 missense possibly damaging 0.63
R1867:Ccdc173 UTSW 2 69781837 splice site probably null
R4821:Ccdc173 UTSW 2 69782108 missense possibly damaging 0.76
R5309:Ccdc173 UTSW 2 69787258 missense possibly damaging 0.92
R5312:Ccdc173 UTSW 2 69787258 missense possibly damaging 0.92
R5916:Ccdc173 UTSW 2 69789462 start codon destroyed probably null 0.95
R6232:Ccdc173 UTSW 2 69772054 missense possibly damaging 0.64
R6236:Ccdc173 UTSW 2 69758041 utr 3 prime probably null
R6909:Ccdc173 UTSW 2 69781848 intron probably null
Predicted Primers PCR Primer
(F):5'- TGGCAGGAAAGTCTCAGATCT -3'
(R):5'- TGTACATATTGCTCACTTGGAAATT -3'

Sequencing Primer
(F):5'- CAGGAAAGTCTCAGATCTATGCTATG -3'
(R):5'- GCTCACTTGGAAATTTTTAGTATAC -3'
Posted On2017-07-14