Incidental Mutation 'R6072:Taf1d'
ID482540
Institutional Source Beutler Lab
Gene Symbol Taf1d
Ensembl Gene ENSMUSG00000031939
Gene NameTATA-box binding protein associated factor, RNA polymerase I, D
SynonymsTAF(I)41, TAFI41, 4930553M18Rik, Josd3
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.836) question?
Stock #R6072 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location15306214-15316991 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 15311560 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 241 (S241P)
Ref Sequence ENSEMBL: ENSMUSP00000149377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034415] [ENSMUST00000164079] [ENSMUST00000213763] [ENSMUST00000214054] [ENSMUST00000215124] [ENSMUST00000216109] [ENSMUST00000216825]
Predicted Effect probably benign
Transcript: ENSMUST00000034415
AA Change: S241P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000034415
Gene: ENSMUSG00000031939
AA Change: S241P

DomainStartEndE-ValueType
Pfam:TAF1D 27 243 4.3e-104 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082700
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082863
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083292
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083331
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083348
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104426
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158304
Predicted Effect probably benign
Transcript: ENSMUST00000164079
AA Change: S241P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000129141
Gene: ENSMUSG00000031939
AA Change: S241P

DomainStartEndE-ValueType
Pfam:TAF1D 27 243 5.4e-99 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198150
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200085
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213235
Predicted Effect probably benign
Transcript: ENSMUST00000213763
AA Change: S241P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213923
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214045
Predicted Effect probably benign
Transcript: ENSMUST00000214054
AA Change: S241P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214221
Predicted Effect probably benign
Transcript: ENSMUST00000214316
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214899
Predicted Effect probably benign
Transcript: ENSMUST00000215124
Predicted Effect unknown
Transcript: ENSMUST00000215749
AA Change: S74P
Predicted Effect probably benign
Transcript: ENSMUST00000216109
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216256
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216768
Predicted Effect probably benign
Transcript: ENSMUST00000216825
AA Change: S241P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] TAF1D is a member of the SL1 complex, which includes TBP (MIM 600075) and TAF1A (MIM 604903), TAF1B (MIM 604904), and TAF1C (MIM 604905), and plays a role in RNA polymerase I transcription (Wang et al., 2004 [PubMed 15520167]; Gorski et al., 2007 [PubMed 17318177]).[supplied by OMIM, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik A T 11: 23,517,357 M92K probably benign Het
3110001I22Rik T C 16: 13,677,489 S151P probably damaging Het
Abca15 T A 7: 120,388,258 C1256S probably damaging Het
Asic2 A G 11: 80,894,088 S291P probably damaging Het
Asph A G 4: 9,643,533 probably null Het
Ccdc173 A T 2: 69,772,058 D336E probably benign Het
Ccdc57 T A 11: 120,902,075 K284N probably damaging Het
Dnm3 CAGCCTTCGTTGGGTG C 1: 162,011,068 probably benign Het
Dopey1 G A 9: 86,507,697 S558N probably benign Het
F830045P16Rik T A 2: 129,472,694 Q221L probably damaging Het
Gm10146 A G 10: 78,393,498 noncoding transcript Het
Gys2 T G 6: 142,428,537 D594A probably damaging Het
Irf9 A G 14: 55,605,827 E114G probably damaging Het
Itpr2 T G 6: 146,347,111 K1082T probably damaging Het
Krt14 C T 11: 100,207,166 G97D unknown Het
Lmo7 A T 14: 101,929,336 probably benign Het
Nckap5l A T 15: 99,426,654 L656Q probably damaging Het
Ndufs8 T C 19: 3,909,275 T129A probably damaging Het
Nosip G A 7: 45,076,648 V187M possibly damaging Het
Olfr723 A T 14: 49,929,149 Y132N probably damaging Het
Olfr830 G A 9: 18,875,422 V29I probably benign Het
Phf3 A C 1: 30,830,688 N426K probably benign Het
Plekha6 G C 1: 133,272,307 R208P possibly damaging Het
Ptpru A G 4: 131,776,228 S1164P probably damaging Het
Rcan1 T C 16: 92,465,927 D51G probably benign Het
Rem1 A G 2: 152,634,517 T232A probably benign Het
Slc1a3 T A 15: 8,708,568 I59F probably damaging Het
Slc23a4 T C 6: 34,948,422 K491E probably benign Het
Slc6a5 T A 7: 49,912,195 D158E probably damaging Het
Smarca4 A G 9: 21,700,121 N1510S probably damaging Het
Thada T C 17: 84,192,006 D1921G possibly damaging Het
Tmem147 A T 7: 30,728,020 M99K possibly damaging Het
Tulp1 T C 17: 28,363,784 E130G possibly damaging Het
Tyw1 T C 5: 130,267,911 V123A possibly damaging Het
Wdr75 T C 1: 45,799,051 V40A probably damaging Het
Zfp683 T C 4: 134,055,746 Y174H probably benign Het
Other mutations in Taf1d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Taf1d APN 9 15311603 missense probably damaging 0.99
IGL01861:Taf1d APN 9 15308739 unclassified probably null
IGL02448:Taf1d APN 9 15310394 nonsense probably null
IGL03106:Taf1d APN 9 15309941 missense possibly damaging 0.83
R0026:Taf1d UTSW 9 15308648 missense probably damaging 1.00
R0026:Taf1d UTSW 9 15308648 missense probably damaging 1.00
R0079:Taf1d UTSW 9 15309944 missense probably benign 0.08
R4298:Taf1d UTSW 9 15308643 missense probably damaging 1.00
R4379:Taf1d UTSW 9 15311981 intron probably benign
R4381:Taf1d UTSW 9 15311981 intron probably benign
R4927:Taf1d UTSW 9 15309954 missense probably damaging 0.99
R5541:Taf1d UTSW 9 15308850 missense probably damaging 0.99
R6736:Taf1d UTSW 9 15307823 critical splice donor site probably null
R7527:Taf1d UTSW 9 15308837 missense not run
X0057:Taf1d UTSW 9 15308520 splice site probably null
Predicted Primers PCR Primer
(F):5'- TTCTAGCCCTGAAAAGCCAG -3'
(R):5'- GTTCTTGATCTACTTGGCATACACTG -3'

Sequencing Primer
(F):5'- GCCCTGAAAAGCCAGTATTTTTAACC -3'
(R):5'- GATCTACTTGGCATACACTGTTATC -3'
Posted On2017-07-14